Transcript asmbl_102726

Sequence
Transcript Sequence for observation asmbl_102726 of TGE0000287:
GACTCTGGCAGTTAGCCCGCCCGCTCGGCGCAGGGCGTGGCTTCTCGTAGCCATTAGGAAACAGCAACCCTTTCACCTCAGTTTTCTTCACTCCGGCATTTGCAGCAGAGCGAAAGGTGGTCGAGTCCTGAAGGAGGGCCTGATGTCTTCATCATTCTCAAATTCTTAGGACGGTCGGGCCCTGGAAGGAACGCTCTCGGAATTGGCCGCGGAAACCGATCTGCCCGTTGTGTTTGTGAAACAGAGAAAGATAGGCGGCCATGGTCCAACCTTGAAGGCTTATCAGGAGGGCAGACTTCAAAAGCTACTAAAAATGAACGGCCCTGAAGATCTTCCCAAGTCCTATGACTATGACCTTATCATCATTGGAGGTGGCTCAGGAGGTCTGGCAGCTGCTAAGGAGGCAGCCCAATATGGCAAGAAGGTGATGGTCCTGGACTTTGTCACTCCCACCCCTCTTGGAACTAGATGGGGTCTCGGAGGAACATGTGTGAATGTGGGTTGCATACCTAAAAAACTGATGCATCAAGCAGCTTTGTTAGGACAAGCCCTGCAAGACTCTCGAAATTATGGATGGAAAGTCGAGGAGACAGTTAAGCATGATTGGGACAGAATGATAGAAGCTGTACAGAATCACATTGGCTCTTTGAATTGGGGCTACCGAGTAGCTCTGCGGGAGAAAAAAGTCGTCTATGAGAATGCTTATGGGCAATTTATTGGTCCTCACAGGATTAAGGCAACAAATAATAAAGGCAAAGAAAAAATTTATTCAGCAGAGAGATTTCTCATTGCCACTGGTGAAAGACCACGTTACTTGGGCATCCCTGGTGACAAAGAATACTGCATCAGCAGTGATGATCTTTTCTCCTTGCCTTACTGCCCGGGTAAGACCCTGGTTGTTGGAGCATCCTATGTCGCTTTGGAGTGCGCTGGATTTCTTGCTGGTATTGGTTTAGACGTCACTGTTATGGTTAGGTCCATTCTTCTTAGAGGATTTGACCAGGACATGGCCAACAAAATTGGTGAACACATGGAAGAACATGGCATCAAGTTTATAAGACAGTTCGTACCAATTAAAGTTGAACAAATTGAAGCAGGGACACCAGGCCGACTCAGAGTAGTAGCTCAGTCCACCAATAGTGAGGAAATCATTGAAGGAGAATATAATACGGTGATGCTGGCAATAGGAAGAGATGCTTGCACAAGAAAAATTGGCTTAGAAACCGTAGGGGTGAAGATAAATGAAAAGACTGGAAAAATACCTGTCACAGATGAAGAACAGACCAATGTGCCTTACATCTATGCCATTGGCGATATATTGGAGGATAAGGTGGAGCTCACCCCAGTTGCAATCCAGGCAGGAAGATTGCTGGCTCAGAGGCTCTATGCAGGTTCCACTGTCAAGTGTGACTATGAAAATGTTCCAACCACTGTATTTACTCCTTTGGAATATGGTGCTTGTGGCCTTTCTGAGGAGAAAGCTGTGGAGAAGTTTGGGGAAGAAAATATTGAGGTTTACCATAGTTACTTTTGGCCATTGGAATGGACGATTCCGTCAAGAGATAACAACAAATGTTATGCAAAAATAATCTGTAATACTAAAGACAATGAACGTGTTGTGGGCTTTCACGTACTGGGTCCAAATGCTGGAGAAGTTACACAAGGCTTTGCAGCTGCGCTCAAATGTGGACTGACCAAAAAGCAGCTGGACAGCACAATTGGAATCCACCCTGTCTGTGCAGAGGTATTCACAACATTGTCTGTGACCAAGCGCTCTGGGGCAAGCATCCTCCAGGCTGGCTGCTGAGGTTAAGCCCCAGTGTGGATGCTGTTGCCAAGACTGCAAACCACTGGCTCGTTTCCGTGCCCAAATCCAAGGCGAAGTTTTCTAGAGGGTTCTTGGGCTCTTGGCACCTGCGTGTCCTGTGCTTACCACCGCCCAAGGCCCCCTTGGATCTCTTGGATAGGAGTTGGTGAATAGAAGGCAGGCAGCATCACACTGGGGTCACTGACAGACTTGAAGCTGACATTTGGCAGGGCATCGAAGGGATGCATCCATGAAGTCACCAGTCTCAAGCCCATGTGGTAGGCGGTGATGGAACAACTGTCAAATCAGTTTTAGCATGACCTTTCCTTGTGGATTTTCTTATTCTCGTTGTCAAGTTTTCTAGGGTTGAATTTTTTTCTTTTTTCTCCATGGTGTTAATGATATTAGAGATGAAAAACGTTAGCAGTTGATTTTTGTCCAAAAGCAAGTCATGGCTAGAGTATCCATGCAAGGTGTCTTGTTGCATGGAAGGGATAGTTTGGCTCCCTTGGAGGCTATGTAGGCTTGTCCCGGGAAAGAGAACTGTCCTGCAGCTGAAATGGACTGTTCTTTACTGACCTGCTCAGCAGTTTCTTCTCTCATATATTCCCAAAACAAGTACATCTGCGATCAACTCTAGCCAAATTTGCCCCTGTGTGCTACATGATGGATGATTATTATTTTAAGGTCTGTTTAGGAAGGGAAATGGCTACTTGGCCAGCCATTGCCTGGCATTTGGTAGTATAGTATGATTCTCACCATTATTTGTCATGGAGGCAGACATACACCAGAAATGGGGGAGAAACAGTACATATCTTTCTGTCTTTAGTTTATTGTGTGCTGGTCTAAGCAAGCTGAGATCATTTGCAATGGAAAACACGTAACTTGTTTAAAAGTTTTTCTGGTAGCTTTAGCTTTATGCTAAAAAAAATAATGACATTGGGTATCTATTTCTTTCTAAGACTACATTAGTAGGAAAATAAGTCTTTTCATGCTTATGATTTAGCTGTTTTGTGGTAATTGCTTTTTAAAGGAAGTTATTAATATCATAAGTTATTATTAATATTTTGAACACAGGTGGATGTGAAGGATTTTCATTTAAAAACCAAGTGGTTTTGACTTTTTCTGTTGAATGAACAACTGTGCCTTGTGGAATTTTTGCAGAAGTGTTTATGCTTTGTTAGCATTTCAACTTGCATTATTATAAAGAGGTATTAATGCCTCAGTTATGTGTTTGTCAATGTACTGGCTGAGGATTCTATCTCAGCTGTCTTTTCTAACTGTGTAGGTTGAGTTTTGAACACGTGCTTGTGGACATCAGGCCTCCTGCCAGCAGTTCTTGAAGCTTCTTTTTCATTCCTGCTACTCTACCTGTATTTCTCAGTTGCAGCACTGAGTGGTCAAAATACATTTCTGGGCCACCTCAGGGAACCCATGCATCTGCCTGGCATTTAGGCAGCAGAGCCCCTGACCGTCCCCCACAGGGCTCTGCCTCACGTCCTCATCTCATTTGGCTGTGTAAAGAAATGGGAAAAGGGAAAAGGAGAGAGCAATTGAGGCAGTTGACCATATTCAGTTTTATTTATTTATTTTTAATTTGTTTTTTTCTCCAAGTCCACCAGTCTCTGAAATTAGAACAGTAGGCGGTATGAGATAATCAGGCCTAATCATGTTGTGATTCTCTTTTCTTAGTGGAGTGGAATGTTCTATCCCCACAAGAAGGATTATATCTTATAGACTTGTCTTGTTCAGATTCTGTATTTACCCATTTTATTGAAACATATACTAAGTTCCATGTATTTTTGTTACAAATCTTCTGAAAAAAAACAAAACAATGTGAAACATTAAAATTAAAAGGCATTAATAATATCCACGTGTGCCTTCTTACTGAATGATGGTCTTGGGAGTCTTTGCAAGAGTATTGAGTAGATCTCTGATATTGTGTTGAAAAGCTAGCTGCTGAGTAGGCTCCAATGATGCTATGCTGATTTAAGTATAGAAGAACTAATCAGTTCATTGCCATTTCCCATCTTCTGGCAGTATCAGGCACATAGATGGTCAATAAATGTTTCCAGAAATGTTGATTACCATGTTCAGATTATGCATTCACATGCACTTAATCTTCTTAGGTATCACTTTTTAAGCAGAAACTCCTCTTTTATGTAATCTTTACCAAAAACCTTCCCAG