Transcript asmbl_101428

Sequence
Transcript Sequence for observation asmbl_101428 of TGE0067092:
CGGCCCCAGGCCCGCCCCTGACACTGAACGCCGCTTGTCCCCTCCGGCTTGCCGTCCTCGCAGCCATGGCGGCCGCCGCGCTCCCAGCATGGCTGTCTCTGCAGTCGAGGGCAAGGACTCTGCGTGCATTCTCCACTGCCGTCTACTCGGCCACTCCGGTCCCGACACCTAGCCTGCCGGAAAGAACACCCGGAAATGAAAGGCCACCAAGAAGAAAGGCACTACCTCCTAGGACAGAGAAAATGGCTGTTGACCAGGACTGGCCTAGTGTTTACCCAGTTGCAGCACCATTTAAACCCTCTGCAGTACCTCTTCCTGTTCGAATGGGTTATCCAGTAAAAAAGGGCGTGCCCATGGCAAAGGAGGGAAATCTAGAACTTTTAAAGATTCCCAATTTTCTGCATTTGACTCCTGTAGCAATTAAAAAGCACTGTGAAGCCCTTAAAGATTTTTGCACTGAGTGGCCAGCCGCACTGGACAGTGACGAGAAATGTGAGAAGCATTTTCCAATTGAAATTGACAGCACTGATTATGTTTCATCAGGACCATCTGTTCGGAACCCCAGAGCACGAGTAGTAGTCTTAAGAGTAAAGCTTTCCAGTTTGAATTTAGATGATCACGCAAAGAAGAAATTAATTAAACTTGTAGGAGAGCGATACTGCAAGACCACAGATGTGCTTACCATCAAAACAGATAGGTGCCCTTTAAGGAGGCAGAATTACGATTATGCAGTGTATCTACTAACAGTGTTATACCATGAGTCTTGGAATACTGAAGAATGGGAAAAAAGTAAGACTGAAGCAGACATGGAAGAGTATATATGGGAAAATAGCTCATCAGAAAGAAATATCCTGGAAACGCTTCTCCAGATGAAAGCTGCTGAGAAAAATATGGAAATAAATAAAGAAGAGCTCCTTGGTACTAAAGAAATTGAAGAGTACAAAAAGTCTGTTGTTAGTCTTAAAAATGAGGAGGAAAATGAAAATTCCATTTCTCAGTACAAAGAATCCGTGAAGAGACTATTAAATGTGACATGAATTATGGAGTAGAAAAATCTGCTTGATTTATTAATTTTATGATATATGTGATCAGTATCTAATTTGATATAAAATTGAAAATGTTAAAAAATCATTTTTTTTCCTCAGAGTTAAAATTATTTCCCTCATACTAATGCTTAATGGCAATGATTACTCCAGAGTTTTTTAATTTTTACACTGGGGCAATAGACTAGGAGGTCTCTGATTTCTTCTTGGTCTAAAGTGTTTTGATTTTATTTCTACATAATAGCTTTGGTATTCATGTATATACATGCATTTAATTGTGATTTTATCACCTTTCCCATTTCTTTCCCCACAAGCTGGCATTTCAGTAGTTGCTTTTGAATAATGGTTTTGGTTACCTGGGAAGGCAGGCCCAGAACCCATTTCCTTGACTTGCAGTTCCGGGCTGTGTTCACATGACTGCTGTCTAGCTGATGCATTTTTCACATTTGTCAACTCTGGTTAGAAACAGGTCCTCAGGAGTATTCTCTAACCTGATATTTTCTAAAAAGATATGTTGATTCAACTTTGTTTAGCATCCTACTTTCTAGATTGTGGGGCTCATTTTGCCAGGGCCAAGCTACCAGAAAAGTAGAAGTGGAGATTACCTGGTATGTATCTCTCTGGGTGCCCCAGTTAGAGCTGCCACAGCTCAGGAAAAAGATGAGGCATAACGACCTTGAATGTAATTGGAGTAAGTGACAAAATAAGAACTACCCTGGGAAACCCTGCATTCAATGTAGCTGTCAATTCAGTATTTTTAAGTACACCTGTCAGCTGTTTCTTACCACTTCGATGGTTGTGATTAATTTAAAATCAAAATAAAGGAATTACTGAGTTTATTTGCCTAATAGACTTATTTTGCCTAGAAGAATTAGAGAGTATAAATGAAAGCCAAAATGGAATTTCACAACGATT