Transcript asmbl_100934

Sequence
Transcript Sequence for observation asmbl_100934 of TGE0000220:
GAAAGTTCTGCACCCCGCCCCCTCTGTCTGCGCTCCCGCTCCTCCCAGCCCCTCCCTCGCGGCGGGGCGGGACCAATCGCTCCCCGAGCCGCTCCTGACCCACCTACCCCAGCTCTCGCGCCGCGTGCAGAGGTGCTCAAGCCTCCTCGCGGTCCGCAGTCAGTGCCGCCGCGCCCGGCCTCCCGCACGCCCCGCAGGTAGCGCCCCCGCCCGCGGCCCAGAGTGCGCTCGCGCCGGCACCAGCTCCCGGATAAACGGCGCGCCGCGCGGAGATGACAGCCGAGGAGATGAAGGCGACCGAGAGCGGGGCGCAGTCGGCGCCGCTGCCCATGGAGGGAGTGGACATCAGCCCCAAACAGGACGAAGGCGTGCTGAAGGTCATCAAGAGAGAGGGCACAGGTACAGAGATGCCCATGATTGGGGACCGAGTCTTTGTCCACTACACTGGCTGGCTATTAGATGGCACAAAGTTTGACTCCAGTCTGGATCGCAAGGACAAATTCTCCTTTGACCTGGGAAAAGGGGAGGTCATCAAGGCTTGGGACATTGCCATAGCCACCATGAAGGTGGGGGAGGTGTGCCACATCACCTGCAAACCAGAATATGCCTACGGTTCAGCAGGCAGTCCTCCAAAGATTCCCCCCAATGCCACGCTTGTATTTGAGGTGGAGTTGTTTGAGTTTAAGGGAGAAGATCTGACGGAAGAGGAAGATGGCGGAATCATTCGCAGAATACAGACTCGCGGTGAAGGCTATGCTAAGCCCAATGAGGGTGCTATCGTGGAGGTTGCACTGGAAGGGTACTACAAGGACAAGCTCTTTGACCAGCGGGAGCTCCGCTTTGAGATTGGCGAGGGGGAGAACCTGGATCTGCCTTATGGTCTGGAGAGGGCCATTCAGCGCATGGAGAAAGGAGAACATTCCATCGTGTACCTCAAGCCCAGCTATGCTTTTGGCAGTGTTGGGAAGGAAAAGTTCCAAATCCCACCAAATGCTGAGCTGAAATATGAATTACACCTCAAGAGTTTTGAAAAGGCCAAGGAGTCTTGGGAGATGAATTCAGAAGAGAAGCTGGAACAGAGCACCATAGTGAAAGAGCGGGGCACTGTGTACTTCAAGGAAGGTAAATACAAGCAAGCTTTACTACAGTATAAGAAGATCGTGTCTTGGCTGGAATATGAGTCTAGTTTTTCCAATGAGGAAGCACAGAAAGCACAGGCCCTTCGACTGGCCTCTCACCTCAACCTGGCCATGTGTCATCTGAAACTACAGGCCTTCTCTGCTGCCATTGAAAGCTGTAACAAGGCCCTAGAACTGGACAGCAACAACGAGAAGGGCCTCTTCCGCCGGGGAGAGGCCCACCTGGCCGTGAATGACTTTGAACTGGCACGGGCTGATTTCCAGAAGGTCCTGCAGCTCTACCCCAACAACAAAGCCGCCAAGACCCAGCTGGCTGTGTGCCAGCAGCGGATCCGAAGGCAGCTTGCCCGGGAGAAGAAGCTCTATGCCAATATGTTTGAGAGGCTGGCTGAGGAGGAGAACAAGGCCAAGGCAGAGGCTTCCTCAGGAGACCATCCCACTGACACAGAGATGAAGGAGGAGCAGAAGAGCAACACGGCAGGGAGCCAGTCTCAGGTGGAGACAGAAGCATAGCCCCTCTCCACCAGCCCTACTCCTGCGGCTGCCTGCCCCCCAGTCTCCCCACTCCACCCTGTTAGTTTTGTAAAAACTGAAGAATTTTGAGTGAATTAGACCTTTATTTTTCTATCTGGTTGGATGGTGGCTTTAGGGGAAGGGGGAAAGGTGTAGGCTGGGGGATTGAGGTGGGGAATCATTTTAGCTGGTGTCAGCCCCTCTTCCCTTCCTCCATTGCACATGAACATATGTCCATCCATATATATTCATCAGAATGTTAATTTATTTTGCTCCCTCTGTTAGGTCCATTTTCTAAGGGTAGAAGAGGCAAGTGGTAGGGATGAGGTCTGATAAGAACCCAGGGTGGAGAGGGAGACTCCTGGGCAGCCGTTTTCCTCATCCTTTCCCTCTCCCAGTCCATTTCCAAATGTGGCCTCCATGTGGGTGCTAGGGACATGGGAAAAACCACTGCTATGCCATTTCTTCTCTCTGTTCCCTTCCTCACCCCCGACGGTGTGGCTGATGATGTCTTCTGGTGTCATGGTGACCACCCCCTGTTCCCTGTTCTGGTATTTCCCCTGTCAGTTTCCCCTCTCGGCCAGGTTGTGTCCCAAAATCCCCTCAGCCTCTTCTCTGCACGTTGCTGAAGGTCCAGGCTTGCCTCAAGTTCCATGCTTGAGCAATAAAGTGGAAACAATAAAACCTGGGTGTCAGACAACCCTTTCTGTTCAGCCTTGGAGTGGTGGGTATGGGTGGGTACATAATGGGTAGTAGCACAATCAAGGGGTCACCCACTTAGTTCCAGTTGAGCTTAAATAAGTGAGCATCTCATGTAGATGCCATAGTTGGGCAGGAAGCAGCCCCACCATGCATGGCTTCCTGAGCACTGCACAGGCTGCCGCTGGGATTTGTGTCTATGGCTTCGCCCAAGGTTCCCAGCACTCCCTCCCTCCAGCAACCTGGCAGTTTTAGTGCCTCTGGTTTTCTTCCCTGACACTTAGGAAGACGAAAGTATAAAGATCTAGAAGACTGGGACACCATGCATGTTCATTTTGAAGTTGGAATTGGTCTTCTGCCTACCTCTGATCTGGCAGAGGTATCTGCATTTTGGTTTGTTAACAAGGTAAAACTCCTGGTGTCACTGACCTCCTCCTGTCAGATAACTTACATGATTAAGGTTAAGAGTAAAGCAGAGTGTTCACGTCCAGCTTCCTTCTCAGCCTTAACAGGAAAAGGCTTGTGCTTTTTTTCTAACTATGCTTTGACCCTTAACTCCTATGGCATGATGGGGCCCTGGGAGAAGCCAGGCAGCACAAGCCAGTCATGCTGAGCTGCCTCCAGATAATCCTGGCTCCAGGCCAGAGCCCGTGTCTGCCCTCATCCCTCTCTCCTACTGTGAGCTCTCCAGTCCTTTCCCAACAGCGATGTGGTTGTCTGCTTAGCCACATGCCTGTATAGTTCCTTCCAGAAGAAATGTATAATGGTGGAAGATGTATTTCTGTGTGAAAATTTTCACCAAGTCATACAACACAGCTGATGCTGGAGCCAGGATTAAAATTGGGGTGTACAAGTCTCCCAGTGTGAGTATCCCTTGAGCCCAAGACACCAAGGATGCAGAGAACTGTGACTGTGCCACTGCACGCCAGCCTGGGCAAGAGAGTGAGACCATCTCT