Transcript asmbl_100196

Sequence
Transcript Sequence for observation asmbl_100196 of TGE0000191:
CGCATCCGTGCGCCGCCCGAGGCTGTCTAAGGAGTCGGCGGCCATTTTGTTCTTCTCGTGGTTCCAGTGGGGAGAGAAGGAGGAAGTAGGGAGCGGGGTGGCAGGGGGGGGACCCGCCGCGGCTGCTGCCACCGCCGCCACCACCGCCTCTGCTCGTGGCGTGGGAAAGGAGGTGTGAGTCCCGGGCGCGAGCCGGCGGCGGCGCCGCTGCGGGAGGGTCGGCGGTGGGAAGGCGATGGCGGATTTAGATAAACTCAACATCGACAGCATTATCCAACGGCTGCTGGAAGTGAGAGGGTCCAAGCCTGGTAAGAATGTCCAGCTTCAGGAGAATGAAATCAGAGGACTGTGCTTAAAGTCTCGTGAAATCTTTCTCAGTCAGCCTATCCTACTAGAACTTGAAGCACCACTCAAAATATGTGGTGACATCCATGGACAATACTATGATTTGCTGCGACTTTTTGAGTACGGTGGTTTCCCACCAGAAAGCAACTACCTGTTTCTTGGGGACTATGTGGACAGGGGAAAGCAGTCATTGGAGACGATCTGCCTCTTACTGGCCTACAAAATAAAATATCCTGAGAATTTTTTTCTTCTCAGAGGGAACCATGAATGTGCCAGCATCAACAGAATTTATGGATTTTATGATGAATGTAAAAGAAGATACAACATTAAACTATGGAAAACTTTCACAGACTGTTTTAACTGTTTACCGATAGCAGCCATCGTGGATGAGAAGATATTCTGCTGTCATGGAGGTTTATCACCAGATCTTCAATCTATGGAGCAGATTCGGCGAATTATGCGACCAACTGATGTACCAGATCAAGGTCTTCTTTGTGATCTTTTGTGGTCTGACCCCGATAAAGATGTCTTAGGCTGGGGTGAAAATGACAGAGGAGTGTCCTTCACATTTGGTGCAGAAGTGGTTGCAAAATTTCTCCATAAGCATGATTTGGATCTTATATGTAGAGCCCATCAGGTGGTTGAAGATGGATATGAATTTTTTGCAAAGAGGCAGTTGGTCACTCTGTTTTCTGCGCCCAATTATTGCGGAGAGTTTGACAATGCAGGTGCCATGATGAGTGTGGATGAAACACTAATGTGTTCTTTTCAGATTTTAAAGCCTGCAGAGAAAAAGAAGCCAAATGCCACGAGACCTGTAACGCCTCCAAGGGGTATGATCACAAAGCAAGCAAAGAAATAGATGTCGTTTTGACACTGCCTAGTCGGGACTTGTAACATAGAGTATATAACCTTCATTTTTAAGACTGTAATGTGTACTGGTCAGCTTGCTCAGATAGATCTGTGTTTGTGGGGGCCCTTCCTTCCATTTTTGATTTAGTGAATGGCATTTGCTGGTTATAACAGCAAATGAAAGACTCTTCACTCCAAAAAGAAAAGTGTTTTGTTTTTTAATTCTCTGTTCCTTTTGCAAACAATTTTAATGATGGTGTTAAAGCTGTACACCCCAGGACAGTTTATCCTGTCTGAGGAGTAAGTGTACAATTGATCTTTTTTAATTCAGTACAACCCATAATCATGTAAATGCTCATTTTCTTTAGGACATAAAGAGAGCCCTAGGGTGCTCTGAATCTGTACATGTTCTTGTCATAAAATGCATACTGTTGATACAAACCACTGTGAACATTTTTTATTTGAGAATTTTGTTTCAAAGGGATTGCTTTTTCCTCTCATTGTCTTGTTATGTACAAACTAGTTTTTATAGCTATCAACATTAGGAGTAACTTTCAACCTTGCCAGCATCACTGGTATGATGTATATTTAATTAAAGCACACTTTTCCCCGACCGTATACTTAAAATGACAAAGCCATTCTTTTAAATATTTGTGACTCTTTCCTAAAGCCAAAGTTTCTGTTGAATTATGTTTTGACACACCCCTAAGTACAAGGTGGTATGGTTGTATACACATGCTGCCTTCTTGGGGATTCAAAAACAGGTTTTTGATTTTGAATAGCAATTAGTGATATAGTGCTGTTTAAGCTACTAACGATAAAAGGTAATAACATTTTATACAATTTCCATATAGTCTATTCATTAAGTAATCTTTTTACAGTTGCATCAGGCCTGAACCCGTCCATTCAGAAAGCTTCAAATTATAGAAACAATACTGTTCTATACGAGTGACCGATTATGCTTTCTTTGGCCTACATTCTTTATTCTGCGGTGAAGTTGAGGCTTATAAGTTAAAACAAAGGAACTAACTTACTGTCCACCAGTTTATACAGAACTCACAGTACCTATGACTTTTTTAAACTAAGATCTGTTAAAAAAGAAATCTGTTTCAACAGATGACCGTGTACAATACCGTGTGGTGAAAATGAATTCAGACTTATTAAATGATGAACTTGTTAAATCTTCTCAGTGTCTATTTATCAGCACAATACACACAGGAGAACTGTTGATGGCATATTGAATAGATTTTCCTGAATAAATTGCTCTGGAAACC