Transcript asmbl_100181

Sequence
Transcript Sequence for observation asmbl_100181 of TGE0067068:
GCGTTTTTCCTCACCTTACTGTATTTTATTTCGGTAAATACCCACACATTTTAATTTCTGAGAGGCACAAATTCCTCTCAGACTCATTCAAATTGACCGAGTAGTCTTATAAGGTGCCTTTTGTCTCATTGTAAATCCTCAGTAAAGTTTGCAGTTTAGGATGATAACGTGATTTTTGCGTAAAAATAACAACTCATTTCACCTGAAAAGGACCACGACAGGAGCAGGGACTCGAGTTTCTTTTTATTCGGGCACTTCAGTAGTTACCTCTTGCTTGGGGGTGGTGCCGCGTGTGGACCCGATGGACCCCGGCGACGCCGCCATTTTGGAGTCTTCCCTAAGGATCCTCTACCGGCTTTTCGAGTCAGTGCTGCCGCCGCTGCCCGCGGCTTTGCAGAGCAGGATGAATGTGATAGACCACGTGCGGGACATGGCGGCCGCGGGGCTGCACTCCAACGTGCGGCTCCTCAGCAGCTTGTTACTTACAATGAGTAATAACAACCCTGAGTTATTCTCCCCACCTCAGAAGTACCAGCTTTTGGTGTATCATGCAGATTCTCTCTTTCATGATAAGGAATATCGGAATGCTGTGAGTAAGTATACCATGGCTTTACAGCAGAAGAAAGCGCTAAGTAAAACTTCAAAAGTGAGACCTTCAACTGGAAATTCTGCATCTACTCCACAAAGTCAGTGTCTTCCATCTGAAATTGAAGTGAAATACAAAATGGCTGAATGTTATACAATGCTAAAACAAGATAAAGATGCCATTGCTATACTTGATGGGATCCCTTCAAGACAAAGAACTCCCAAAATAAACATGATGCTGGCAAACCTGTACAAGAAGGCTGGTCAGGAGCGCCCTTCAGTCACCAGCTATAAGGAGGTGCTGAGGCAGTGCCCATTAGCCCTTGATGCCATTCTAGGCTTGTTGTCCCTTTCTGTAAAAGGGGCAGAGGTGGCATCCATGACAATGAATGTGATCCAAACCGTGCCTAACTTGGACTGGCTCTCTGTGTGGATCAAAGCGTATGCTTTTGTGCACACTGGTGACAACTCAAGAGCAATCAGTACCATCTGTTCACTAGAGAAAAAATCCTTATTGCGAGATAACGTGGACCTATTGGGAAGCTTGGCAGATCTGTACTTCAGAGCTGGAGACAATAAAAACTCTGTCCTCAAGTTTGAACAGGCACAGATGTTGGATCCTTATCTGATAAAAGGAATGGATGTATATGGCTACCTACTGGCACGAGAAGGGCGGCTAGAGGATGTTGAGAACCTTGGATGCCGCCTTTTCAATATCTCTGATCAGCATGCAGAACCGTGGGTGGTTTCTGGCTGTCACAGCTTCTATAGCAAACGCTACTCCCGGGCCCTCTATTTAGGAGCCAAGGCCATTCAGCTGAACAGTAATAGTGTTCAAGCTCTGCTACTTAAGGGAGCAGCACTTAGGAACATGGGCAGAGTCCAAGAAGCAATAATCCACTTTCGGGAGGCCATACGGCTCGCACCTTGTCGCTTAGATTGTTATGAAGGTCTTATCGAATGTTACTTAGCCTCCAACAGTATTCGAGAAGCAATGGTAATGGCTAACAACGTTTACAAAACTCTGGGAGCAAATGCACAGACCCTTACCCTTTTAGCCACCGTTTGTCTTGAAGACCCAGTGACACAGGAGAAAGCCAAAACATTATTAGATAAAGCCCTGACCCAAAGGCCAGATTACATTAAGGCTGTGGTGAAAAAAGCAGAACTACTTAGCAGAGAACAGAAATATGAAGATGGAATTGCTTTGCTGAGGAACGCACTGGCTAATCAGAGTGACTGTGTCCTGCATCGGATCCTAGGAGATTTCCTTGTAGCTGTCAATGAGTATCAGGAGGCAATGGACCAGTATAGTATAGCACTAAGTTTGGACCCCAATGACCAGAAGTCTCTAGAGGGGATGCAGAAGATGGAGAAGGAGGAGAGTCCCACGGATGCCACTCAGGAGGAGGATGTGGACGACATGGAAGGGAGTGGGGAAGAAGGGGACCTGGAGGGCAGCGACAGTGAGGCGGCCCAGTGGGCTGACCAGGAGCAGTGGTTCGGCATGCAGTGAGGGGGCGGCAGCTCCATGGCCGCAGTGGCCTGCCCTGCTCTGAGCACTTCCGTGGACTGAAGGAACCGTAGGAGCCTGCTCTCAGAAGGACAATGATTCAGCATGTGATTGCAGCAGGGGTCTCTGCCCCCTCGCTCCCAATTCCTAGTCGTGACTTCATTTCTAAAACAGAGCCTGACCAACCTTCCATGTATCTCCATCCTCCCCTGCTCCAGCCAGGGAGGACTGAGGGAGTGCCCCGAGACCCACGCACATGTTGGGGCTTCTGGGCCAAGAGTACTTTTTATATAACTAATTTCTAAATCCAAAAGCTCAAGGAATAGACAGTGTTCTGTGACATGGATTGGTTTGAAGGAGTTACCCACCATCCCAGCACGATAATGTCATCTCCCAAGTTGGATGGCAGCACGATCTGGCCCTAGGGAGCTTCCTGTTCCCAGAAGTCATTGTCCTGGGCTATCCAGATGTCCCTAGTAAATCTTGCTTCCTTCTGCAATGTTAGTAATGCCTTAAGCTGACAGTTGCTATTTTGCAGAACAGTTTTCCTCTTTGCTTAGCTAGTAACTTGCCTCTGAGCCTGGGCTGATCTGAGAAACAGGTGTGACAAGAGCATGAACCAGAGGTGCACCTGGGGCAGTTCCCTAATAAAACTGGTTTGTACAGTCATGGTGTTGGGGTGATCAGAATGGAAGCCCTTTTCAAAATAGACTCTTAGTATTTTTGTCTTATTCGCAATGCATTGATTCAGCCCCAGAATTATTTGCCAGAAATAGACTTTCTTCCCCTGGTGTTGGGAGCCAGGAGGGTTGGAAAGCTCAGGAACCCTGAGCTGGTTCATCTGTTTGCATATTGGGTAGGTTAATTTCCCTGGAGCCTGAGAGTCTTTGGCCAGATTTCAGCTGCGTCTGCCTGGCTCTTTTGCTGCAGCTGTGAGATTGGGGTCTGGTTCCAGCAGTCTGTCACTGGTCAGCCTGAGTATCACACCCTGAGCTCTGGGGCTGGGAGTTTCTTCCCACACCCTCTCCCTTGTGCCTTAAGTTGCGATGGCTCTGAGTATACAATTAATCGGAGGTGAGGGGTGGGTGTCACAGCTAATCCCAAATTCAAAAATTAGTCCAAGGTGCTGCAAAATATAAATTTGATGTCAGTAGAAAGTCGTATCCTAAAATGTAAAAACTGTAAGTGTACAGTAGTTAATGAGCTCAGAACATCTGATAACTGCAATTTAAAATGGGCAAAAAGTTTCTATGAGTCTTTCAGTCTAAGACCCAAAGCCTGCGCAACATCACTTGATCTGAGCCACTTCTAAAGAGACATATAAGGCTAGGCGTGCTCACACCTGTAATCACAGCAC