Transcript asmbl_43726

Sequence
Transcript Sequence for observation asmbl_43726 of TGE0005590:
GCGCCTCCTCCCTGAGCTAACTGTGTGCGCCCCAGCCGCGCGCAGCTACTCGCGTCCGAGCCTCGCGCAAGCTCTCGTGTGTGCCGTGTCGTTTGGCGTCCACCTACCCCTCCGCTCTCCTTGCAAGTACCCCGCGCGTCTGCCACGCAGTCATGTCGTCCGGCAGCCGCGTTGCGCTGGTGACCGGCGCCAACAAGGGCATCGGCCTTGCCATTGTGCGCGACCTGTGCCGGCAGTTCTCCGGGGACGTGGTGCTCACAGCGCGGGACGCGGCGCGGGGCCAGGCAGCCGTGCAGCAGCTGCAGGCCGAGGGCCTGAGCCCGCGCTTCCACCAGCTGGACATCGACGACCTGCAGAGCATCCGCGCCCTGCGCGACTTTCTGCGCAAGGAGTACGGGGGCCTGGACGTGCTGGTCAACAACGCCGGCATCGCCTTCAAGTTAAAGGATCCCACACCGTTTCATATACAAGCAGAAGTGACAATGAAAACAAACTTTTTTGGTACCCGAGATGTCTCCACGGAACTACTGCCTCTCATGAAACCCCAAGGCAGAGTGGTGAATGTGTCCAGCAGCGTAAGCCTCACTGCTCTCAGGAGCTGCAGCCCAGAGCTGCAGCAGCAGTTTAGAAGCGAGACCATCAGTGAGGAGGAGCTGGTGGGGCTCATGAACAAGTTCGTGGAAGATGCGAAGAACGGTGTGCACCAGGAGGCGGGCTGGCCTACTAACGCCTACGGAGTGACGAAAATCGGTGTCACGGTCCTGTCCAGAATCCAGGCCAGGAACCTGAGCACGCAGAGGAAAGGGGACAAGATCCTCCTGAATGCCTGCTGTCCAGGGTGGGTGAGAACTGACATGGCGGGATCCAGAGCCCCCAAAAGCCCGGAGGAAGGCGCAGAAACCCCCGTGTACTTGGCCCTTTTGCCCTCGGATGCTACAGAGCCTCATGGGCAGTTTGTTAAGGAGAAAAAAGTTGAACAGTGGTGAGTGAGCTCAACCCATAGAGCTCCATCCATAGTTTCCATGTTGTACCCGTCCTGATTTGATCCAAAGTGTGTTTAACACAGTCAAAACTATCCCTACCAAGGATTCACTTTGAATTGTCTACCAATTCTATGAAGCCTTTTGTAATTTGTGATGTTTATGCAGTTCTCTGTGATATTCTATAGGGAGAACACATGTGTTAGTGCTGATAATAACGAATTAAAATCAATAGAGG