Transcript asmbl_43654

Sequence
Transcript Sequence for observation asmbl_43654 of TGE0005575:
TCCCTTTCTTCCTGTCTGGCTGAAAGATGGCGTCTCGCAAGGAAGGCACCGGCTCTGCCACCACCTCTTCCAGCTCCACCACAGGTGCGGCAGGAAAAGGCAAAGGCAAAGGCGGGTCTGGAGATTCGGCCGTCAAGCAAGTGCAGATAGATGGCTTGGTGGTATTAAAGATAATCAAACATTATCAAGAAGAAGGACAAGGAACTGAGGTGGTTCAAGGAGTACTTTTGGGCCTGGTTGTAGAAGATCGGCTTGAAATCACCAACTGCTTTCCTTTCCCGCAGCACACAGAGGACGATGCCGACTTTGACGAAGTCCAGTATCAGATGGAAATGATGCGGAGCCTTCGCCATGTAAACATTGACCACCTCCACGTGGGCTGGTACCAGTCCACCTACTACGGCTCGTTCGTCACCCGGGCACTCCTGGATTCCCAGTTCAGTTACCAGCATGCCATTGAAGAATCTGTCGTTCTCATTTACGATCCCATAAAAACTGCCCAAGGGTCTCTCTCACTGAAGGCATACAGACTGACTCCTAAACTGATGGAAGTTTGTAAAGAGAAGGATTTTTCCCCTGAAGCATTGAAAAAGGGAAGTATCACCTTTGAGCACATGTTTGAAGAAGTGCCGATCGTAATTAAAAATTCACATCTGATCAACGTCCTAATGTGGGAGCTTGAGAAGAAGTCAGCTGTGGCAGATAAACATGAATTGCTCAGTCTTGCTAGCAGCAATCATTTGGGAAAGAATCTACAGTTGCTGATGGACAGAGTGGATGAAATGAGCCAAGATATAGTTAAATATAACACATACATGAGGAACACGAGTAAACAGCAGCAGCAGAAACACCAGTATCAGCAGCGTCGCCAGCAGGAGAATATGCAGCGCCAGAGCCGAGGGGAGCCCCCGCTTCCTGAGGAGGATCTGTCCAAACTCTTCAAGCCTCTGCAGCCTCCAGCCAGGATGGAGTCTCTGCTCATTGCAGGCCAGATTAATACTTACTGCCAGAACATCAAGGAGTTCACTGCCCAAAACTTAGGCAAACTCTTCATGGCCCAGGCGCTTCAAGAATACAACAACTAAGAAAAAGAAGTTTCCAGAAAAGGAGTTAACATGGACTCTTGAGATCACATTGGGGCAACTCTTGGAAGAAATATGTTTGCATACTGAAAAGTCTTTTTAGCCAATAATAAAGTATAAATAAAACAGTCTTGCCTACTCGCTTA