Transcript asmbl_43636

Sequence
Transcript Sequence for observation asmbl_43636 of TGE0005584:
CCGGGCCTGATCAGTCCAGTGGGACACGAACGGAGATAGTGTACGGGATTGTTCTCTCTGCGGGGCCTCAAGGGAAAAGGAATAGCTATGTCATCCTTGATCAAAAAGGTGATCAGCACCGTGAAAGCCCCAGGGGCCATTGGTCCCTACAGTCAAGCTGTGTTAGTCGACAGGACCATTTACATTTCAGGACAGATAGGCATGGACCCTTCAAGTGGACAACTTGTGCCAGGAGGTGTGGTAGAAGAAGCTAAACAAGCTCTTACAAACATGGGTGAAATTCTGAAAGCTGCAGGCTGTGACTTCACTAATGTGGTAAAAACAACTGTTTTGCTGGCTGACATAAATGACTTTGGTACTGTCAATGAAATCTATAAACAGTATTTCAAAAGTGATTTTCCTGCAAGAGCTGCTTACCAGGTTGCTGCTTTGCCCAAAGGAGGCCGTGTTGAGATTGAAGCAGTAGCTATCCAAGGCCCTCTCACAACAGCATCACTCTAAGCAGGCCTAATAATATTTAGTCTGGAATATTAATAATGTTTTAAAATATATTAATTTTTATAATCAATGTTGGAAAGTATAAGACAGACTAAAATATCTGAAGTATAAAGAAAATACCATATAATAAGGGGACTTGAACATGAATTACAGATGAAATGATGAATCCACTCACTGATGTTATAAAGAACAGTTATGCATGCCCACATGCCTGGATGCGAGAGGAGACACATTGCGTTACGTAGTCACTCAAACAAATAAAAGGAAATAACACTCAGGAAATATGAGTTACTATTCCTGAGAAATAGTGAAGAGTACATGTATTAGTTAAATACTAATAATTTGATGGTGTGAAATATTTAGTTCTCATGTCAAATATGTGATTCTGCTTTTACTTGAGTAAAATTAAAGATTTAAGTTTGAATGGTAGACGTAAAGGCAAAAAAAAGTGGACCAAAATTGTATATAGCTAATATTTTTCTAATGGAAATAAATTAGACTTGCAGATTTT