Transcript asmbl_43632

Sequence
Transcript Sequence for observation asmbl_43632 of TGE0009594:
NNNNNCTCCGGGGCGGGAGGGGGATCCGCCGCGGAGTTACGGGAAAGTTGTTCCGAGTTCCTGGAGTTTCCTCTGTGGTTCCCGGGCTCCGCCGGCCGGTGGCCCGGCCTCTTTCCTCCCTCTGGCCTTCCCTGCTCACCAGGTCCTTCCTTTAGCCCCCGGCCGCCATGGAGCAGCCGCCGGCCCCCAAGAGTAAGTTAAAAAAGCTGAGTGAAGACAGTTTGACTAAGCAGCCTGAAGAAGTTTTTGATGTGTTAGAGAAACTTGGAGAAGGGTCTTATGGAAGTGTGTTTAAAGCAATACATAAGGAATCTGGCCAAGTTGTGGCAATTAAACAAGTACCTGTTGAATCAGATCTTCAGGAAATAATCAAAGAAATTTCCATAATGCAGCAATGTGACAGCCCATATGTTGTAAAGTACTATGGCAGTTACTTTAAGAACACAGACCTCTGGATTGTTATGGAATACTGTGGAGCAGGCTCTGTCTCGGACATAATTAGATTACGAAACAAGACATTAACAGAAGACGAAATTGCAACTATTCTTAAATCTACTTTGAAAGGACTAGAATATTTACACTTTATGAGAAAAATACACAGAGATATAAAAGCTGGAAATATTCTCCTCAATACAGAAGGACATGCAAAATTGGCAGATTTTGGTGTGGCTGGTCAGTTAACGGATACAATGGCAAAACGCAATACTGTGATAGGAACCCCATTTTGGATGGCTCCTGAGGTAATTCAAGAAATAGGATATAACTGTGTGGCTGACATCTGGTCCCTTGGCATTACTTCCATAGAGATGGCCGAAGGAAAACCTCCTTATGCTGACATACATCCAATGAGGGCTATTTTTATGATTCCTACAAATCCACCACCAACATTCAGGAAACCAGAACTTTGGTCTGATGATTTCACCGATTTTGTTAAAAAGTGCCTAGTGAAGAATCCTGAGCAGAGAGCTACTGCAACACAACTTTTACAGCATCCTTTTATCAAGAATGCAAAACCTGTTTCGATTTTAAGAGATCTGATCACAGAAGCTATGGAGATCAAAGCAAAAAGACACGAAGAACAGCAGCGAGAATTGGAAGAGGAGGAAGAAAATTCGGATGAAGATGAACTGGATTCTCACACCATGGTGAAGACGAGTTCAGAAAGTGTGGGCACGATGAGGGCCACAAGCACGATGAGTGAAGGAGCCCAGACCATGATTGAACATAATAGTACGATGTTAGAGTCTGACTTAGGGACCATGGTTATAAACAGTGAGGATGAAGAAGAAGAAGATGGAACTATGAAAAGAAATGCAACTGCACCACAAGTACAAAGACCGTCTTTTATGGACTACTTTGATAAACAGGACTTCAAAAATAAGAGTCATGAAAACTGTAATCAGAACATGCATGAACCCTTCCCTATGTCCAAAAATGTTTTTCCTGATAACTGGAAAGTTCCTCAAGATGGAGACTTTGACTTTTTAAAAAATCTAAGTATAGAAGAACTGCAAATGCGGTTAAAAGCTCTGGACCCCATGATGGAACGAGAAATAGAAGAGCTTCGTCAGAGATACACTGCAAAAAGACAACCCATTCTGGACGCA