Transcript asmbl_11383

Sequence
Transcript Sequence for observation asmbl_11383 of TGE0000102:
CAGGCGCACACCGCCTCCGCGGCAGCATGGCGGACGCAGCTCCTCAACTAGGCAAGAGGAAGCGCGAATTGGACGTGGAGGAGGCCCACGCCGCCAGCACAGAGGAAAAGGAGGCAGGAGTTGGAAATGGTACCTGTGCTCCTGTCCGCTTACCGTTCTCCGGCTTCAGACTGCAGAAGGTGCTGAGGGAGTCTGCGCGGGACAAAATCATTTTCCTACACGGGAAGGTGAATGAGGCCTCTGGGGATGGGGATGGAGAGGATGCCGTTGTGATCCTGGAGAAGACGCCATTTCAGGTGGAACAGGTGGCTCAGCTCCTGACGGGCAGCCCTGAGCTCCAGTTGCAGTTCTCCAATGATATCTACAGCACCTATCACTTGTTCCCTCCAAGACAACTGAATGATGTAAAGACGACCGTGGTTTACCCTGCCACAGAGAAACACCTGCAGAAGTACCTGCGCCAGGACCTCCGCCTGATCCGAGAGACGGGAGATGACTACAGGAATATTACTTTACCCCACCTGGAGTCCCAGAGCCTCAGCATCCAGTGGGTGTATAACATTCTCGACAAGAAGGCTGAAGCGGACCGGATTGTTTTCGAGAACCCAGATCCCTCTGATGGTTTTGTCCTCATCCCTGACCTCAAGTGGAACCAACAGCAGCTCGATGACTTGTACTTGATCGCCATCTGCCATCGCCGGGGCATCAGATCCCTACGCGACCTTACTCCGGAGCACTTGCCGCTGCTCAGGAACATCCTCCACCAGGGGCAGGAGGCCATCCTGCAGCGCTACCGGATGAAGGGAGACCATCTGCGAGTATACCTGCACTACCTGCCCTCCTACTACCACCTGCATGTGCACTTCACCGCCCTGGGCTTCGAGGCCCCCGGCTCAGGCGTGGAGCGGGCCCACCTGCTGGCTGAGGTGATCGAGAACTTGGAGTGTGACCCTAGGCACTACCAGCAGCGCACGCTCACCTTCGCCCTCAGGGCTGACGACCCCCTGCTCAAGCTCTTGCAGGAGGCTCAGCAAAGCTGAATTAACTCAGGCAGAAGAGCACAGATGTGTGGGATTGGGGGAGGAGTGGGGACAAGATTTTTTATCTCCAAGTGAATTTTCTAAAAATGTATTTTATACCGGCTTATTCCTAGTATTGAATAAACTAGCGGGCTCACTCAGTGTGGACAGCGTGGCCTGGGAGGCAGACAGATGGTGGGGGACAGTGGGTGGGTAGAACCTGTGGGAAGGCCTTGA