Transcript asmbl_42484

Sequence
Transcript Sequence for observation asmbl_42484 of TGE0005515:
GAACCGGGCTGTGGGGGGCGCGGGGCCGGGACAGGGGCAGTGGCCAAAGACCAGCGGTGACAGCATGGGTGAAGGGGAGTGTGGCAGGGGAGGCCTTGGGCTGCCTTGGGCGGTGGATGGGACTGCGGGGCTGGAGGCCTGGAATCCTGGGTCCAGGCCAGAGATCTGACCCGTGGTTGGTGTCCCCCGAACCCTCAGCGTGGCCCGTCTTGTCCTCGCCATGAGGCCGCAGCAGGCGCCGGTGTCCGGGAAAGTATTCATTCAGCGAGACTACAGCAGTGGCACACGCTGCCAGTTCCAGACCAAGTTCCCCGCGGAGCTGGAGAACCGGATTGATAGGCAGCAGTTTGAAGAAACAGTTCGAACTCTAAATAACCTTTATGCAGAAGCAGAGAAGCTTGGGGGTCAATCATATCTTGAAGGCTGTTTGGCTTGTTTAACAGCATATACCATCTTCTTATGCATGGAAACTCATTATGAGAAGGTTCTGAAGAAAGTCTCCAAATACATTCAAGAGCAGAATGAGAAGATATATGCTCCCCAAGGCCTCCTCCTGACAGATCCCATTGAGAGAGGACTTCGAGTTATTGAAATTACCATTTATGAAGACAGAGGCATGAGCAGTGGAAGATAAACATAGAATTAAAGATCCCAACTCTAGCTGGGACCCTCATCTGTCCACTGGCCAATCGCAGAGTGTCCCCTACCTCCTCTCCAGAGCGTCATTCCTTTGTATCTGCTGCCAGAGCCACGGTGCCATTTCCTCCAAGGACTAACTTTCTAATATTCCACACCTGGAGTGACCTCTCGTCGCTCAGCATCCACTTTATGTCTCCAAATTGTGTAGGACTCTGTAATCTTTTGATTAGTTTCTGAGAAAACACAATGAAGCATTTCACTTTTTTATTCAAAGCCATTAATAAAATATGTAGTTAGTCAGCCCAACTCAAAGTTTATTTCTTATCTGCCACCAGTCCCAAATGGTTCTCGTCATTCCTTGGCCCAGCTTCCCAGGTGGCTGTAGACTTCAAAGTGATGTTAGCCAGTGTTCAGTCTTATTCCCCAAATAAAATGCTTTACTCCAGGATTTCAGTGAAGGGTAGGCTGTGTCTGTGGTTTTGCTAATGCATGTCCCAGATTTCAAAGAACTACCAGTTTTGCCATGACTCAAATCTTAAAGATGTTTCTGCCATTCAGTTTCTCAAACTGAAGCTCATTGGAAAAATAATGTGTAATGTTATTTGTTTTATTATAGCAATTATTCCTAATTAAAGCAGT