Transcript asmbl_42467

Sequence
Transcript Sequence for observation asmbl_42467 of TGE0005512:
GGAGGCAGGGGCGCGCAGGCGCCGCGGGGGGAGTGAGGCCGCGCAGGCGCGGACGGCGTTGGTTGAAGAAGACCTTCAGCGTTGCCCTGGCGGAGCGGAGACCGGCTCTCTCTGGGTGGAGATATGTGTAACACACCGACTTACTGTGACCTAGGAAAGGCTGCCAAGGATGTCTTCAACAAAGGATATGGGTTTGGCATGGTAAAAATAGATCTGAGAACCAAGTCATGTAGTGGAGTGGAATTTTCTACTTCTGGTCATGCGTACACTGATACAGGGAAAGCGTCAGGCAACCTAGAGACCAAATATAAGGTCTGTAACTATGGACTTACCTTCACCCAAAAATGGAACACAGACAATACTCTTGGAACAGAAATCTCTTGGGAGAATAAGTTGGCTGAAGGGTTGAAACTGACTCTTGATACCATCTTTGTACCGAACACAGGGAAGAAGAGTGGGAAATTGAAGGCCTCCTATAAACGGGATTGTTTCAGTCTTGGCAGTAATGTTGATATAGATTTTTCTGGACCAACCATCTATGGCTGGGCTGTGTTAGCCCTTGAAGGTTGGCTTGCTGGCTATCAGATGAGTTTTGACACAGCCAAATCTAAACTGTCACAGAATAATTTCGCCCTGGGTTATAAGGCTGCAGATTTCCAGCTGCACACTCACGTGAATGATGGCACTGAATTTGGAGGGTCTATCTACCAGAAGGTTAATGAGAAGATTGAAACGTCAATAAACCTCGCTTGGACAGCTGGCAGTAACAATACCTGTATTGGCATCGCTGCTAAATACAAGCTGGATTGTAGAACTTCTTTATCTGCCAAAGTAAATAATGCCAGCCTGATTGGACTTGGTTATACTCAGACCCTTCGACCAGGAGTCAAACTGACCCTGTCAGCTTTAGTCGATGGAAAGAACTTCAATGCAGGAGGTCACAAGGTTGGGTTGGGATTCGAACTAGAAGCTTAATGTGGTTTTGAATAAAGCATCAAATTTGTTCCTGGAGGTGAAGAGAAATGAATCCACTATGTTTTGGCCTTAAAATTCTTCTCTGAAATTTCAAAAGTGTGAACTTTTTATTCTTCCAAAGAATTGTAATCCTCCCCACGCTGAAGTCTAGAGATCGCAAGTCCACCCTAAGGGAGGTCCTTAAAGGCATGCCTGGAAGTTGTTATGTTTGTGCCACATTTCAGTTCCGCAGTATTATTTTAAATGTGTTCCTCGGCGACAATGTAGTGTCATGTTAAAGGAAATGACTCGATCCTCCAGTTTGTACATCACGTCCTGCATGTCCCACACCACTTTTTCATGACCGTTTAATATATTGGTCTGTGTGCTGTAGTGGAATCTTTGGTTTTGCATCAGGGTATAATAAAATAAACCCATCACATTTGAACATAATTGCTCATCTTACTTGCTAGTAGTGGTTTTCTTATATTTGGTGTGATTTGCTTTGAAAAGTACTCTCATAGGTGAGAGTATATGCCTAAAGTGGTATGTCTGAAACATCTATGCTGTCTCTTGCCTGTCCTTTGCACTTTAGATTACTTCACTCTTATTGCTGCTCTGCAGTTGGGCCGAGGAGTGAAACTGAGTTTTGTTCTGCTGAGCAGAAGCACCTCTCTCGTGGTACCTGCTTCCTATTGCAGTGTGATAGAGTACTTTTGTAAAGCTACTGAGAAAGAGTGAGGGTGTGAGTGGGCAAAAGATGGGCAAAGGAAAGAGTATAATT