Transcript asmbl_42417

Sequence
Transcript Sequence for observation asmbl_42417 of TGE0005501:
TAGCCCCAGACGGTAAACAGGAAATGGGACTCTATCTGGGACTCAATATTCGGGTGAAAAAGACCCGGGATTCAGTTGAGACGTCTACTGCTGCTTTTGCGTACACTTTCAGGGTGTACCGTCCTCCATCTCCACTGTTTGCCTCTCTCTCCTGTTCCTGTTCCAATCAAGGTATTTTGTCTTGAGCCACCTCCCACCTCTTTATCGAGAAGTGTCACCAGAACCATGGCTGAATACTCCTATGTGAAGTCCACCAAACTCGTGCTCAAAGGAACCAAAGCTAAGAGTAAGAAGAAAAAGAGCAAAGAGAAGAAGAGAAAAAGAGAAGATGATGAAGAAACCCAACTTGATATTGTTGGAATTTGGTGGACAGTAACAAACTTCGGTGAAATTTCAGGAACCATAGCAATTGAAATGGATAAAGGAACCTACATACATGCCCTTGACAATGGACTTTTTACACTGGGAGCTCCACATAAAGAAGTTGATGAAGGCCCTAGTCCTCCAGAGCAGTTTACAGCTGTCAAATTGTCTGATTCTAGAATTGCCCTGAAATCTGGCTATGGAAAATACCTTGGTATAAATTCAGATGGACTTGTTGTTGGGCGTTCAGATGCAATTGGACCAAGAGAACAATGGGAACCGGTCTTTCAAGATGGGAAAATGGCTTTATTGGCCTCAAATAGTTGCTTTATTAGATGCAATGAAGCAGGTGATATAGAAGCAAAAAGTAAAACAGCAGGAGAAGAAGAAATGATAAAGATTAGATCCTGTGCTGAAAGAGAAACTAAGAAAAAAGATGATATTCCTGAAGAAGACAAAGGAAATGTTAAACAGTGTGAAATCAATTATGTGAAGAAATTTCAAAGCTTCCAAGACCACAAACTTAAAATAAGTAAAGAAGACAGTAAAATTCTTAAAAAGGCCCGGAAAGATGGATTTTTGCATGAAACACTTCTGGATAGGAGAGCCAAATTGAAAGCTGATAGATACTGCAAATGACCAGGATTTTT