Transcript asmbl_42130

Sequence
Transcript Sequence for observation asmbl_42130 of TGE0009510:
GGAGGAGGAGGACGAGGACGAGGAGGACGGGGAGAGAGGCTGCACCTTCCTGGTGGGCCTCATCCAGAAGCACCGGCGGCGGCAGAGGAAGATGGGAGAGGACATGCACACCATTGGCTTCGGCATCTACGAGGTTCCAGAGGAGTTGACGGGACAGACCAACATCCACCTCCCCAAAAACTTCTTCCTGACGCACAGAGCGAGGGAGCGGTCGGACACCTTCATCAACCTGCGGGAGGTGCTCAACCGCTTCAAGCTGCCCCCGGGGGAGTACGTCCTCGTGCCTTCCACCTTCGAACCCAACAAGGACGGGGACTTCTGCATCCGGGTCTTTTCTGAGAAGAAGGCCGACTACCAGGTGGTCGATGATGACATCGAAGGCAACCTTGACGAGATTGACGTCAGCGAGGACGACATTGATGACGGATTCAGGAGGCTGTTTGCCCAGCTGGCAGGGGAGGACGCGGAGATCTCTGCCTTCGAGTTGCAGACGATCCTGAGGAGAGTGCTCGCCAAGCGCCAAGACATCAAGTCAGATGGCTTCAGCATCGAGACCTGCAAAATCATGGTTGACATGCTAGACTCGGATGGCAGTGGCAAGCTGGGCCTGAAGGAGTTCTACATTCTCTGGACGAAGATCCAAAAATACCAAAAAATCTACCGGGAAATCGATGTGGACAGGTCTGGTACCATGAACTCCTATGAGATGCGGAAGGCGTTAGAAGAAGCAGGTTTCAAGCTGCCCTGTCAACTCCACCAAGTCATCGTTGCTCGCTTTGCAGATGACCAGCTCATCATCGATTTCGATAATTTTGTTCGGTGTTTGGTTCGACTGGAAACGCTCTTCAGGATATTTAAGCAGCTGGATCCCGAGAACACGGGAACGATACAGCTCGACCTTATCTCTTGGCTCTGTTTTTCAGTACTTTGAAGTGATGACTAATCTGCCTGAAGACTTCTTATGAAAGAAAATCAGCCACGGACTAAGCTTCCACTAAGCTTCCACGGAGAAACTTTTTATCTAGACCTTAATCATGGGAACATTTATGTAAACTGATGATTATAGTTGAAAATAATGATACCATTTGAGATAGAACTTTCAGATATCAAAGTAAAAGATTTGCATATCATTATACTCAATGCAAGTGAGTCGCTTAACCCTGGACAAGCTCAAAGCTTTAAATCTGTAAATGGTACCCACTTTGTACTTTTACACACAATCCTGTTTAGAGCAATATTAAATCAGGAAAAAAATGCAGGGAGGTATTTAACAGCTGGGCAAACATTCAGTCAATGTCAAAGGACACGAGGTCCTTGCTGGAAATATTGAAAGCAACTTCGAGTTTAAAAACGCTGCTGTGGCAGCAGCTCGGGGCTCACCATTTCCCTTGAGTAAAATGGAAAATATGATGCCTCATGAAGTAATCTTGTCAAGGCATCTGAAGAGGCCAGGTGAGAATGCTCGCCTCTGTCACTTGGGTTAGACAAGAGACAGGTTTTCTATAATACTGACTGGTTAACAGTAAATCTGAAACTCAAGTCCCTGAGTGTGCCTGGTCTTATACAGTGTTATAAATACCGGAGGGGTTCTAGTCATGGTCGGCTGAAGTGATACACTGAAACCAGGCGGCGTTTGCAGACGAGGTGTGGCTAAGACAAAACGAGCTGTTTGCTGCCGGCTTCGAAACGTCTCAAAAGTCTCCACCTCTGGTGTTTGTGCCCGGAGTTGGGACCCGGCCTGGGAGTACGCGTGGAAACAAAACGTGTTCCTTGGCTTTACTTTCTGAAAATTCTAACATTATAAAAATATTGCCTTGTTGCCTTACCTTCTACCGAACGTACTGTTAATAAAGAGTCTCCCAG