Transcript asmbl_42046

Sequence
Transcript Sequence for observation asmbl_42046 of TGE0005472:
GTCCCGGCGGTGTGAGTATGGGCGCTTGGTCTGACCTTCAGTAATCTGGCTCCATCCTCTTCCGGGATTGCGTTCACCGAGACAGCGGGGTCTGTCCTGAGCTGGCCCGGGGCTGCGCGTTCCGAGGGATGGAAATTAGCACTGCGTTTAAGGGCTCGTAGCTTGGGAGGGAGAATGGCTCAGAGGAGCCCAGGGCTGCTAGGGTTTCCGGGATGGAGGCACCTGAGGGGAGCGGATTCTTGTGCCGGGAATGGCCGGCTTGGCTTTGCCCCTACCTGGGGAATCGGGGCCCTGGCCGGGCCCTCTGCACCCGGGAGCTTCCCGAGGGCGGCCGCATGAGGGAAGGCCCGGGAGGGAGGACTTGGCTTGTGCTTGTCTCACTCTGCTCTGATCCTCCATGTTGCCTGGATTTAGATGGCTCCCGCGAAGAAGGGTAGCGAGAAGAAGAAGGGCCGTTCTGCCATCAACGAGGTGGTGACCAGAGAATATACCATCAACATTCACAAGCGCATCCATGGAGTGGGTTTCAAGAAGCGTGCTCCTCGGGCACTCAAAGAGATCCGGAAATTCGCCATGAAGGAGATGGGGACTCCAGATGTACGCATCGATACCAGGCTCAACAAGGCCGTCTGGGCCAAAGGGATCAGGAATGTCCCATACCGTATCCGGGTGCGGTTGTCCAGAAAACGTAACGAAGATGAAGATTCACCTAACAAGCTCTATACATTAGTTACCTATGTGCCTGTCACCACTTTCAAAAATCTACAGACAGTTAATGTGGATGAGAACTAACTGCTGATTGTCGAATAAAGATACAAAACTGCCTTTGAGGTTTGGTTTCTCGTTTCTGGTTGCAATGTAATAACTGTGTATCTTAAAGTAGTTCCCAATTATAGAATCACTTGGAAAGCTTTTCCTAAGTACTATGCCTGTGTCCTTTGTCCCCAGCCTCTCGAGTTTCTGAATATTTGGACAGGGCCCAAGCAGTTTTAAGTGATTTTGAAGTGTATGTAGCCTCACTTTAGAATAACTGCTTAGGTAGCTGGGAAAGTGGAGATACATAGGTTAGTTTTTTTTACCTGCATGTTTCGTTAATTCTAAGATAAACATTTTTCCAGAAACTGCCATGTAGAACTCAGCTGCTCTTGGCTTCTTTTCATTTTAAACCAAAATGAGGCAATTGACAGCATCTTAGATTTCATGAAATATATTTGGTAGTATGTCCTTAAGCTTCTGCCTATATCTGTATTGAATGTAACTCTCAAAAGGTATATAATTGTCATCTAAAATAGATTTTTGATGGTGTAAATGCTTAATGATATGCTTAATTTATATGTACAGTTAATATTTTAGTTCACCTACTAGTAATGGCCCCATGAAGAATTTTTAGTGCTAGCTTACGTGGCGCTAAAGCTCAGAGGTAAAGCTGCTTATACATCCAAATCTGAATTCAGCCTGAAAGGAAGGCGCTGCAAGGATTACA