Transcript asmbl_41017

Sequence
Transcript Sequence for observation asmbl_41017 of TGE0009481:
GCAGACTTGCCAGTGCCCCAGGTGAACGAGCAGAGGGACCTGGACCCCGGTCGGATGCAGATGCTGCAGGGGAACCCGCTGCTGCTCCCACACAGCCTGCAGGAGCTGCTGGCCAAGGACACCGTGCAAGTGGCCCTCGTCCCCGAGAGGAAGGGCCTCTTCCTGAAGCATGTGGAGTACGAAGTGTCCAGCCAGCGCTTCGGGGCCTCCGTGAGCCGCCGGTACAACGACTTCGTGGTTTTCCACGACCTGCTGCTCCAGAAGTTCCCCTACCGCATGGTGCCGGCCCTGCCGCCCAAGAAGATGCTGGGAGCTGACAGGGAGTTCATCGAAGCCCGGAGGAGAGCCCTGAAGCGCTTCATTAACCTGGTGGCCCGGCACCCCCCCTTCTCCGAGGACGTGGTGCTCAAGCTGTTCCTGTCCTTCAGCGGCCCCGACGTGCAGAGCAAGCTAAAGGAATCGGCTCAGTGTATGGGAGACGAATTCACGAACTGTAAGCTGGCGACGCGGGCCAAGGACTTCCTCCCAGCTGACATCCAGACTCAGTTCGCAGTTAGCCGGGAGCTGATCCGAAATGTCTACAACAGCTTTTACAAGCTTCGTGATCGGGCCGAGAGGATTGCGTCAAGGGCCATCGACAATGCTGCTGACCTCCTCATATTCGGGAAGGAGCTAAGTGCTTTAGGGTCTGACACGACACCGCTCCCCTCCTGGGCCGCTCTGCACAGCAGCACGTGGGGGTCCCTCAAACAGGCGCTGAAAGGGCTCTCTGTTGAGTTTGCACTGCTCGCTGACAAGGCCGCCCAGCAGGGCAAAAAGGAAGAGAACGATGTGGTGGAGAAGTTGAACCTCTTCCTGGATCTGCTCCAGTCCTACAAGGACCTGTGCGAGCGGCACGAGAAGGGCGTGCTGCACAAGCACCAGCGGGCGCTGCACAAGTACAGCCTGATGCGGAGGCAGATGAGCGCGGCCGTGCACGGCCAGCAGCCCGAGGCCGTGCAGCAGCTGGAGTCGCGCATCGTGGAGGAGAGCACGATCCAGACGATGGAGCTGCGGCACGCCTTCTCCCTGTACTGCCTGCACCAGGAGACGCAGCTGGTCCACGCCCACCTGCCCCTCACCTCCCACATCCTCGGGGCCTTCGTCAACTCCCAGATCCAAGGGCACAAGGAGATGAGCAAGGTGTGGGACGACCTGAAGCCCAAGCTGCACTGCCTCTTCGCTGGACCCAACAGCACCTGACCCTGCCAGGGTCCCCAGGGATGGCCTGTCTCCTCACTAGTGCTGCGAGGACCCGGGGCGCAAAACCCACCGGCGCCCTCACTAAAACTTCTTTCCAAACGGTGTGTCCCTGTTTGATTCCCTTCAGAGAGCAGCTGTCCCCCATGTCCCGCGGGCTGCCGCCCTCAAGCAGGAGAGCTGACGTCAGGGCTGGCAGGTCCGGTGCGACGGCGCAGAGCCGAGGACACGGCTGTGGGCTCAGGCTGTGGCCGTCCTGGCCCAGCGCTGTGGCCTGAGGCTTGTGCTGGAAAGCGTCGGCCCCTGGGATGGCTTCCCCTGGGACCTGGAGGCCAGCGTGCGGCAGAGGTTTTCACAGCACACGGTGCCCGGGGGGTGCAGGGGCCCTGTGCTGGAGCAGCCGGAGAGGGAGGCCGAAACCCTGTGGAGGGCAGGAATGTCCCTGCGGTGGCATGTCACCCTGGATGAGGCACAACTGATGAGTGAGAGGGCAGTCCTGGGCGGGGGGTGAGTGTGCGAGGCGGCTGCTGGGGCCAGCAGGGCAGGTGCAGCTGGGGGCCGCTGGGCATGAGCGTTTCGCTTCCACAGAATGAGCTCCCGCGAGCGTCTCGTGTCCCTACACATGCGTGTGCATGTGCACACACTCTGTGACCCAGGTGTGCCCGTGGTCTGAGGTGTGGCAGACAGGGTGGCCTGGTGCTTCCGCTGTCCGTCCCTGTACCAGGAGCTGCT