Transcript asmbl_41016

Sequence
Transcript Sequence for observation asmbl_41016 of TGE0005438:
GCAGACTTGCCAGTGCCCCAGGTGAACGAGCAGAGGGACCTGGACCCCGGTCGGATGCAGATGCTGCAGGGGAACCCGCTGCTGCTCCCACACAGCCTGCAGGAGCTGCTGGCCAAGGACACCGTGCAAGTGGCCCTCGTCCCCGAGAGGAAGGGCCTCTTCCTGAAGCATGTGGAGTACGAAGTGTCCAGCCAGCGCTTCGGGGCCTCCGTGAGCCGCCGGTACAACGACTTCGTGGTTTTCCACGACCTGCTGCTCCAGAAGTTCCCCTACCGCATGGTGCCGGCCCTGCCGCCCAAGAAGATGCTGGGAGCTGACAGGGAGTTCATCGAAGCCCGGAGGAGAGCCCTGAAGCGCTTCATTAACCTGGTGGCCCGGCACCCCCCCTTCTCCGAGGACGTGGTGCTCAAGCTGTTCCTGTCCTTCAGCGGCCCCGTGAGTACCTCAGGGACAGGCAGCCCCACTGCTCTGGGCCATGCTGGAGTCTGCAGATGTAGAGCGTGGCCCCAGGTGACGCTGTGCCCCTGGGGACGTGAGCTGAGCTGGAGGCACGCAAGTCCCGAGAAACGCACTCTGCACCACGTCAGTGTCAGAAGCCCAAGCGCCAGTGTCCTCCACACTGCGGTCCCGCAGTTGAGATGAGTCAGGAAGCCAAGGAGCTGCTCCCAGTCGGGGAGGAAGACTTCATGGCAGGCCGCCTCGTCCCCAGGGCTGTCACCTGTTCTGTAGGAAGGGACCTTCTCACTGGGGCGGGGTGAGGGAGCTCCGATGGGGTCGATGCGTTCGGTCCCCACCGTTAGAGAGGACCCCTTCTTGTGCAGGCACCTGGGAAGGGGCTCGGCCTGGGGTCAGCGTGGCAGAGGTGGCAGTGGCTGGGACCCTGGACCGGGCCTCAGGCTCTCCCACTGTGATCCCAGGGGACGGCGGGTGCTGCCCCTTCATGGGATCGGTGCCAGACAGGGAGTGCTTGCCGCGACCTGCCCGTGAGCTGGG