Transcript asmbl_40958

Sequence
Transcript Sequence for observation asmbl_40958 of TGE0005420:
AGTGAAGAACAAGAAGCTGCTGCTCCTGGCTGTGTCCGAGTTGTGGCGGTGGCGGTGGCGTGCGGCCGGCGTGGGTGCGTGGCAGGCTGGCCGCAGCAGGGGACGTGTCTGCACTTCTAACCTCTGCCTCCCCGCATTGCTTCTCCTCCTGCAGTATGATTTGACGTCGCGAACATGGACTTTTCTCGGCTCCACATGTACACGCCGCCGCAGTGTGTGCCCGAGAACACTGGCTACACATACGCACTCAGTTCAAGCTATTCTTCCGATGCTCTGGACTTCGAGACTGAGCACAAGTTGGATCCCGTGTTTGATTCTCCAAGAATGTCCCGCCGTAGTTTGCGCCTGGTCACCACAGCGTACACCACCGATGGTGGCCAGGCTGGGGACATTCACTCCTGCGACAGCAGCATGGCCTCCCTGAAGGACAGAGCGGCCAGAGCAGCAAAGCAGCGCAGAGGCGCAGGGAAGCTGGCCTGGAGCGTGAACCACACGTCCGGAAAGGTCGCGGCTGGCCTGCAAGGTGCCGCTGGTCTGCGGCCTCCCGTGCTAGATGCGTCCCTGATCCGCGAGCAGACCAGAGTGGACCACTTCTGGGGTCTTGACGATGACGGAGATGTGAAAGGTGGAAGTAAGGCTGTCACTCAGGGAAATGGCGACGTGGCGGCGGACGCGGCCAGGAGCAACGGCTACACCTGCAGTGACTGCAGCCTGCTGTCCGAGCGCAGGAACACGCTCACCGCGTGCTCTGCCTCCCAGGGGACAGTGTCGCGGATCTACTCGAGGGACAGGAACCAAAAACGCGGCGCGTCTTTCTACACGGATAGGATTTTGTGGCTGGCCAAGTACGTTTCGTCATCTCTTTCATCATTGTTAGTTCAACTTTTTCAAGTGGTTTTAATGAAGCTCAATCGCGAATCAGAAAATTACAAATTGAAAAGTTACGAATCAAAAGATCGTGAATCAGAAAGCTATAACTCAAAAAGCCGTGAATCAAAAGCTCGGCCTGGCGACAGAGGGAGGATGGACGTGAAAGGCGTCCTCGGAGAGGACGGCCACCTCAGGGAGAATGGGGAGTCGTCGTGCGATGACTGTAAGGGGAAGCAGCGCCTTGAGACACAGCCAGCCAGCCACTGGCAGTCTTCCGGGCCATGGAGCGTGGCAGGGACCGTTGGGCACACCTTTTCTCAAGCAGGTCGCTTCTTGACGCAGACCCTGCAGAGGACCCGAGCGGCAGGGTGGTTTGTGTCGGAGACGGTGTTGTCGGTTCTTTGGTTGGCCATGGTGGCTCCAGGGAAGGCAGCCTCTGGAATATTCTGGTGGCTGGGGAGTGGCTGGTACCAGTTTGTTACTTTGATTTCTTGGCTGAATGTGTTTCTTCTTACAAGGTGCCTTCGAAATATTTGCAAGCTTTTAATCTTGCTCATTCCACTGCTGCTTTTACTGGGTGCAGGCCTTTCACTCTGGGGCCAGGGCGGTCCCCTGTCGTTCCTGCCCGCGGTGAACTGGACACACGTGTACAGAGCGCAGAGGGCGGACGGCCCCGGGAGCACCTTCTCGCCTGACGGTCCCCGCCCGAGCCCACCCCTCGAGGCTGGTGATGGGACCGTTGGCTGGCGTCGGATGGGTGAAGTGGAAAGGTGGATGACGTCTTTGTCTGGACAGTGCCAGAGCCACGATGAGCGGCTCAGAGACTTGACAGCCTCGCTTCAGAAGCTGCAGATGCGCGTGGACCAGATGGACGGCGGCAGGGAGGGGGTGTCGTCCTTGGTGAGCCACGTGGTGAGCCAGCGTTTGAAGGAGATGAGTGCCGACGGACTCTTGGGCCCCAAGGCTGACCACGTGACCGCCCACCAAGACCATGGCGCACGCATCGCAAACCTGGAAGATGTTCTCGGAAAACTGACAGAAAAGTCTGAGGTCATCCAGAAGGAGCTAGAACAGACCAAGCAAAGGACAATGAGCGGGCTCGAGGAAGAGCAGCGCCTCCTGTCGGTGGTGAAGCAGCTGCAGCTGGAGCTGAGTCTCCTGAAATCAGAGCTGTCGCAGGGGCAGCATGTGACCCCCAGCTGCGAGCAGGGGGATGCCATCCACGAAAAGGTGGACGCCCGGGTCAGGGAGACGCTCGGGCTCCTGGTGTCGGACGGGCAGTGGGCCGGCGTGCTGGAAGGGCTGCTCCAGAAGCTGTCTTCGCAGTTTGTCGGCAAGGACGACTTACAGGTGTTGTTACGAGACTTGGAGCTGCGGATACTGAAGGAGGTGACCCACCGTGTTTCCGTGACAAAGCAGATCCCCACGTCTGAAACGATCATGTCTGCTGTGAACGACGCCGGGGTTTCTGGAATAACAGAAGCGCAAGCGCACGTCATTGTGAACAATGCATTGAAGCTCTATTCCCAGGACAAGACCGGCATGGTGGACTTTGCTCTGGAGTCCGGCGGCGGCAGCGTCCTGAGCACCCGCTGCTCCGAGACCTACGAGACCAGGACCGCGCTCGTCAGCCTGTTCGGGGTGCCGCTCTGGTACTTCTCCCAGTCGCCCCGCGTCGTGATCCAGCCTGACATGTACCCGGGGAATTGCTGGGCGTTCAGAGGCTCCCAGGGGTACCTGGTGGTGAGGCTGTCCATGAAGATCCACCCAACCAGCTTCGCCCTGGAGCACATCCCAAAGGCACTGTCGCCCACCGGCAACATCAGCAGCGCCCCCAAGGACTTCGCGGTCTACGGACTGGAAAATGAATACGAGGAAGAAGGGGAGCTGCTGGGCCAGTTTGTGTACGATCAGGAAGGGGAGTCGCTCCAGATGTTCCATGCTCCGAAAAGACCCGAACGAGCTTTCCAAATCGTGGAGCTTCGGGTTCTGTCCAACTGGGGCCATCCCGAGTACACGTGTCTCTACCGGTTCAGAGTCCACGGGGAGCCTATCAAGTAGGCCTCTCCTCGCTCCTCTTGTACATTCTGTATATACTGGGACAGCCCGAAACACTGGATCCTCCCTGAACGAGGCGTAGGACGGACAGCATGACGTCGTCTGTTAAATAAACGTTACTGACCGCCAGCAGCAGGACTGGGGATTGAAGCGGCGACGCCGTGCGCCCAGCTGGCCGTTGTGTCCGCGGGAAACACTGCATGTTGAGTGCTCGGGTTTACGGGGGCCGCTGGCAGCGGTGGCTTCGGAAATGCATTTGAATGTATGGTTCGCAAAGACACTTAACTTCGTTTTGGGGATTTGTTTTTAAACATAAAGCTCTTTATACCTGTCTTTCCTTGACGTCAGGAGCAAAGCAAATGAAGTTGAAAGGTTTGAAGTGTTCTCGAAACTTTCACCGGCCCTTTTAAAGGACTTTGAGGGGGTCGGGGGCGGGGGTTACCTTTTCAGTCCAGCATACGTATCTTTCAGGGAGAAACAATGTCACCAAGTTTCAGGGTTCCAAGCTCCTTTCCTTTAGGGTGGGGGTTTTCTTTTATTCAGTACCACTAGTTATTTTAAGTTGCCAGGTGGGGAAACGCCTAAAATGTGTTCTTCTGCTCAGTTTGCTCTACTTCTGAGAAAGATTTGCAAGGTCAGGGCTCAGCGTGCCGCTCTCCATGCGGGACCACGGGGGAGTTCGGTTTCGTTTCATTGCGGGTTGCAGTGGTTCTGACTGGAAGGGGGACAGTCCGGATCCAGACCCCGAGAAAGAGCTCTCAGGTCCGCCAGGCTCATCCCGTTGGGATCGCCCCGGAGTGTCCACTTCACAGCTCGAGTGGGAACTGAGGAATCCAACGGTTGGGTGTTTTCAGGTTGTCTTTTGAATTTGGCTGAAAAGCGAACACTAACGTGCTCCGGATCTCTCAGAGGCTCATGTTTTGAATCCACTGATGCGCTTATCAAAGGGGGACTGGTCAGTGCGGCGAATTCATAGAACCGTTAGGTCTCGTGACCATGACTTTCCTCACAGTGGCACTTTCTACTGGCTCTGGTGGGGATTTGCCTCTTAGGACGACCGTCAACCATTCTCCCTCAAGTCCTGCGAGTCTCATTTAGGTTATAATTAATATTTCATACTGAGACTGTTATACTGAGCAGACTTTATAAATGAGATGTCCACAAGGCACTTAAAGTGTTACAGATGTTTTACCTTAAAATTATTTAAGTTTTATTGGGTTAAGACAGTTTCTTGGTGTACCATAAATCCTGTATTTTTCAGAAAAAAAGATAAAATGATGGTGCTGACTGGTTTTCTGAAGAGTTTTATGTAAATTGCACAACAGTCCTCAAACATACAAAAACTACATAACAGAAAGTAGCATTTTTTCACTTACAATCAGAACTAATGCCTATGCAGTTAAGTTGGATACAATGTACACAGATGTTTCATATATTACGGGATAAATATATAAATCAAAATTTCCTATATTAAACAGTTGGGGAGTTGGGGTGGAAATATTTTGAATATTAATTTATTTTTAAAGATGCAAGATAGGACTTTGTGCAATGTATTTTTGTAAATGCTTTTCAAAATATTTGTCTTTGGTAGTCTTTCTTTTGCTGCCACCAAATTGATAAGATGCTATTGAAATGTTTAAATAAAGAGTTTTAATTTTTAAAAGTGCATGTGAAATTTCAAATGGATAATAAACAGTATATTTCTTTTCTCAAA