Transcript asmbl_40859

Sequence
Transcript Sequence for observation asmbl_40859 of TGE0009462:
ATCAGCAGAGCCGCCTGTGGCCCCAGCTGTAAGGCTGCCTTTACCAGGGAAATGAAAGAGTCTTTTCACTCCCCGCTTCTTCCCTCCCCCTGCCAGGCCCAGCATCATCATCACTCCCATCTTCCTTCTGTGACTGCATCCTTCTTTTCTGGAAGGAAATCATAAGCAACCTGTCCAGGGAGGATTGCTCCGGAAAATGTTGCAAGAGCCACAAAATGGGGAACCTGCCGAAATTAAGATCATCAAGGAAGCATACAAGAAGGCCTTTTTGTTTGTTAATAAAGGACTGAATACAGATGAATTAGGGCAGAAGGAAGAAGCAAAGAACTACTATAAGCAAGGAATAGGACACCTGCTCAGAGGAATCAGCGTTTCATCAACAGACCCTGAATACACAGGTCCCGAGTGGGAATCTGCTAGGCAGATGCAGCAGAAAATGAAAGAAACACTACAGAATGTACGTACCAGGTTGGAAATTCTAGAGAAGGGTCTTGCCACTTCTCTGCGGAATGATCTTCAGGAGGTGCCCAAGTTATATCCAGAATTTCCACCTAAAGACGTGTCCAAAAAGTCACCGGAGCCTCAGTCCTTTGGTTCACCTCCTCAGCACACTGAAGTAAATGGCAACACCTCAACTTCAAGTACAGGATCGGTTCCTGCGCCTAGTTCTCTATCCATACCATCTCAGAGTCATCCAGCAGAAGCACCTCCTGCTTACACTCCTCAAGCTGCTGAGGGTCACTACACTGTATCCTATGGAACGGAATCTGGGGAGTTTTCATCAGTTGGAGAAGACTTTTATAGAAATCATTCTCAGCCACCTCCTCTTGAGAGCTTAGGGCTAGATGCAGATGAGTTGATTTTGATACCAAATGGAGTACAGATTTTTTTTGTAAATCCTGCAGGAGAGGTTAGTGCACCTTCATATCCCGGGTACCTTAGAATCGTGAGATTCTTAGATAATTCTCTGGATACAGTCCTAAACCGTCCTCCTGGGTTTCTTCAGGTGTGTGGCTGGTTGTATCCTCTAGTTCCTGATAGATCTCCAGTTCTTAAATGTACTGTGGGAGCCTACATGTTTCCTGATACAATGTTGCAAGCATCAGGATGCTTCGTGGGAGTCGTCTTGTCTTCTGAATTACCAGAAGATGATAGAGAACTCTTCGAGGATCTGTTAAGACAAATGTCTGACCTTCGGCTTCAGGCCAACTGGAACCGGGCTGAAGGAGAAAACGAATTCCAAATCCCTGGCAGAGCAAGGAGCCCCTCTGACCAACTGAAGGAAGCCAGTGGCTCCGATGTGAGACAGGTAGGTCCTTCATTGGACCAAGGCAGTAAGGATGTGCGTCATAAAGGAAAATGGGGGAAAAAGGCTAAAGGTACTTCAAGTGAAGAAGTTAATCTGAGTCATATGGTGCCCTATGAGCCAGTTGCAGAAGAAAAAGCAAAGGAACTACCTGAATGGAGTGAGAAAGTGGCTCAAAACATTTTGTCAGGTATTACAGTAATGTTAACATTTTCCTCCTTTAATTGTG