Transcript asmbl_40305

Sequence
Transcript Sequence for observation asmbl_40305 of TGE0005367:
TACTATCCGCGGCCCGGAGAACTGCCGCTTGCCGCCATTGACACGCACAGATAGAACCTAAAGAAAGGCAAAGAGTCCTGCCCGGCACCGGCGCCGTGCGGGCCGAACCTGCGCCCGGGGAGCGGCGCGCAGAGGGCACCGGGCGCCGGGAGCAGGCGGCGCAGCACCAGCATTGTGTAGTGTTGGGAGGTCACTGTGTAAGCAAGCTGAGAGGGAAACTGAGGCAAGATGTCGGGCCGGAGCGGGAAGAAGAAAATGTCTAAGCTGTCCCGTTCAGCCAGGGCTGGTGTCATCTTCCCAGTGGGGAGACTGATGCGTTACCTGAAGAAAGGGACATTCAAGTACCGGATCAGCGTGGGTGCTCCCGTATACATGGCAGCAGTCATCGAGTACCTAGCAGCGGAAATTCTAGAATTGGCTGGGAATGCCGCAAGGGACAACAAGAAGGCCCGCATAGCCCCAAGACACATCCTGTTGGCAGTTGCCAATGATGAGGAGCTCAATCAGCTGCTAAAAGGAGTGACCATCGCCAGTGGAGGTGTCCTGCCCAGAATTCACCCTGAACTGCTGGCCAAAAAGCGAGGGACCAAAGGCAAGTCGGAAACCATCCTCTCCCCGCCCCCAGAGAAAAGGGGAAGAAAGGCCACGTCAGGAAAGAAGGGGGGCAAGAAATCCAAGGCTGCCAAACCACGGACGTCCAAAAAGTCCAAAGCAAAGGACAGTGATAAAGAAGGAACTTCAAATTCCACTTCTGAAGATGGGCCAGGGGATGGATTCACCATTTTGTCTTCTAAGAGCCTTGTTCTAGGGCAGAAGCTGTCCCTGACCCAGAGTGACATCAGCCATATTGGCTCTATGAGAGTGGAGGGCATTGTCCACCCAACCACAGCCGAAATTGACCTCAAAGAAGATATAGGTAAGGCCTTGGAAAAGGCTGGGGGAAAAGAGTTCTTGGAAACAGTAAAAGAGCTCCGCAAATCCCAGGGCCCTTTGGAAGTTGCTGAAGCCGCCGTCAGCCAATCCAGCGGACTTGCAGCTAAATTTGTCATCCACTGTCACATCCCTCAGTGGGGCTCCGACAAATGTGAAGAGCAGCTTGAAGAGACCATCAAAAACTGCCTGTCAGCGGCAGAGGACAAGAAGCTAAAGTCTGTTGCCTTCCCACCCTTCCCCAGTGGCAGAAACTGCTTCCCCAAACAGACGGCCGCCCAGGTAACCCTCAAAGCCATCTCAGCCCATTTCGACGACTCAAGTGCATCCTCGTTGAAGAACGTCTACTTCCTGCTCTTCGACAGCGAGAGCATCGGCATCTACGTGCAGGAGATGGCCAAGCTCGACACCAAGTAGCCGCCTCAGCCACGGCTGCACTTTGCAACAGGAGTCGGAGGAAAATCAAAGTCGTAGGAGTTGGTTTTGTTTTTTAAAAGGAAAGAGGAAGGGTGCCGCAGGGGAGTGGAGGGCAGCTGAAGGGAAGCGGGTGGCAAAGGCTGCAGGAGCAGGTCCCGCCTACAGAAGGAGCCCTTTGCATTTTATATTGTTAAAAAGATCCTCAATCCTAAAAACCAGGTCTCCACGAGGGGTCTTTCCATGTGTTTTCCCCCTGTTGTTTTAGAACTTTTTAAAAAAACAGACTTCGTTTTAGATTTATAGCACTGACTTTTACACACACACACACACACACACA