Transcript asmbl_4014

Sequence
Transcript Sequence for observation asmbl_4014 of TGE0005329:
GGCGGCGGTGGCAGCGGCGGCGGTGGCAACGGCGGCAGCTGTGAAGGTGTTCCGGGAAGATGGTGCTGATCAAGGAATTTCGTGTGGTTTTGCCCTGTTCTGTTCAGGAGTATCAAGTTGGGCAGCTTTACTCTGTTGCAGAAGCTAGTAAGAATGAGACTGGTGGTGGAGAAGGAATTGAAGTCTTAAAGAATGAACCTTATGAGAAGGATGGAGAAAAGGGACAGTATACACACAAAATCTATCACCTAAAGAGCAAAGTTCCTGCATTCGTGAGGATGATTGCTCCCGAGGGCTCCTTGGTATTTCATGAGAAAGCCTGGAACGCATACCCCTACTGTAGAACAATTGTAACGAATGAATATATGAAAGATGATTTCTTCATTAAAATTGAAACATGGCACAAACCAGACTTGGGAACATTAGAAAATGTACATGGTTTAGATCCAAACACATGGAAAACTGTTGAAATTGTCCACATAGATATTGCAGATCGAAGTCAAGTTGAACCAACAGACTACAAAGCTGATGAAGACCCAGCATTATTCCAGTCAGCCAAGACCAAAAGAGGCCCTTTGGGACCCAACTGGAAGAAGGAGCTGGCAAACAACCCAGACTGTCCTCAGATGTGTGCCTATAAACTGGTGACCATCAAATTCAAGTGGTGGGGACTGCAAAGCAAAGTAGAGAACTTCATTCAAAAGCAAGAGAAAAGGATATTTACAAACTTTCATCGCCAACTTTTTTGTTGGATTGACAAGTGGATTGATCTGACAATGGAAGACATTAGGCGAATGGAAGATGAAACTCAGAAAGAACTAGAAACAATGCGTAAGAAGGGTTCCGTCCGAGGCACGTCGGCTGCTGATGTCTAGATGAGTCCCCTGTAGGGTCAGAGACAATATCAAACTGTTTACGTAATCAAGGTCAAGTAAGGGGAACAAGTGCAGCCAGTGATGAGTGAAGAAGAATCTGAACAGTATCTTGCAGTATTGGTGTTTCCCAGACGTGTGCTTGTGACTATCTAGTCACATGCACAGGTTCCCAGCCATGTGTGTATATATGTTTGTGTGTGTATATCCGTAGCTGTATATAAAATGCATGTAGAGCTACAGATCAGAATACACACACGTGTATATATATGTACATATAAACATACCGAAGGGATTAGTACAATTTCTCTTAAGTACTGTACCTATCTTCAGCAAGAATGCAAAAGAATATTTTCAATATGTATACCTGGAACAGATTTTAATAATCAGAGTAATATCATGAATGGACAAATTGACTGCAGTGTGATACTAGCTAGTATGTTTCATAAATGTCAAGTTGTGGACCAATATATACATATATAAATATATAGCCTTTTATTACTTTCCTTTTAAATCAGTCTCTTATAAATTTTTATTTCAGTCTCATAAGCAACAGACGCCCACAGAAAAATTATTCAAAATCTTTTTGCTATCAGCGAACGTAAACTCTGAATGTACATATAACGGTTTCTTTCTGGATGGTCATTATCTTACAGCCAAATTGGACAATATCTATTAGTAAGGAGTAAAGTTATAGGCCAGTTTTTACTTGTTTGCTTTGAGGGACAAAATCCTTTTAAAAAATTACTGGTTTTTATTGGATTTTTGTATTTAAATTTCAAGTATTTTTCTACATCAGACACAGCAAAAATGAGATGATGGTTTGTGATGTATAATAAACACGATACAATTTTTAGGCTCCTGTGAGTCAAACAAAGAAATTAATGAAGAAATTAATAGCATTGTAGGCTGTTTAGAAAAATTGGAAGTACAAGTGCTTCCACAGAGTCTTGTTTTTGAAATGACTGTTTTCTGAAATTACAGCTTGGAAACTATGCAAATGATTTAGATTCCTCACAGCTTACACGATAGACTATAGATAGTGATGATGTTTTGCTCTTTTCATGTTGAAACACACTTTAAGGGGGAGATGCTGACTTTGAATTAGGAAGAATTTAAGAGGCAGCTTGAGGCTCGCCTGCACACAGGAGGCCCTGCCCAGGAGCCGGTGCACCTCCACCCATTTGGCTGTGCTCTCAAGGAGGATGTCGTTGGAACATACCCTGAATAAGCATCGTGAAAACGCTGGTTAGAAGCTGCTGCTGCTGCCTTATTTTATTTTATTTTTTAAGAGAGGAACAATAGGTAAGATTTTTATCAGCTTTCTCTGTCCAAGTCCAGTTTTTCTCCTGTCAGTCCTGAAAGCTTGAATAGAATGATATTGTTGAAGCCTTCAGGTCACAAACTGTCGTCTTAACCTCTCGTCCCTCCTACAACACGCCAGCCCCTGTAGTCACATCACATTAGTAATCTGATTTGCTGACAGTCCTCCCCCCCCGCCCCCGCTTCTCTTTTCCCACATGTCCTGTGTCCCCAACAAAGTGATCGTAGTGACTGAGACAAGGATGTCTTCTGCATTACGATACCCTGTTATCCTCAGCCACAAACCCCACATTGCATATGTCCTCTGTGTACTCAGGATCAAGACTGATGTTTACTCTCTGGGCGCTATTGTAAGATAGGTTTTGTCAACACATAATCATTGTCTGCAAAGTGATGCAAGGAAGGAAGATTATTGCTAATTTTGTGAAATAAAGAGTCTAGCCCTCTCCTTTTAATGAACTTAACTCTCGCTGGCATCTGTAGCATCATTGGGAGCTTGGGCACACATGGAAATGAGAACCCAGCGCATGGATTTTAATGTTTTTCTAACAACTGTGGAGATTTGAGGGAATGTGTGGTGAATGTAAAATATCTAGTTTACTTGGCAGTCTCTTGTGTAAATTACAGTAAAATAAAGTAAATGAAATTTAAACAAAAAATAAATTTGATCACAAAATG