Transcript asmbl_39606

Sequence
Transcript Sequence for observation asmbl_39606 of TGE0005318:
CCCGTACCCGGAACAACAAAGCCCGAAAGACGGAGCCCGAGCCTCGGGGGCTCCTTAGCAACGGGCCGGGGCGGGAGTTCCATGGAGACTGGGGAGCGCGCCCGCCTCATCATCATCCTTGCCCTCCAGCTTATCCTTCGCGTCCGACGCAACCGGCAGCACTGCTGCCGCCGCGTCCTCTGCCACCGCCACCTTTTCCCACGGATGTGATCTTCGTGGTGGGAAGCTAAGTTTTTAAACTACCCCAATGGATGCAGACAGTGATGTTGCATTGGACATTCTGATTACAAATGTAGTCTGTGTTTTTAGAACAAGATGTCATTTGAACTTAAGGAAGATTGCTTTGGAGGGAGCAAATGTAATTTATAAGCGTGACGTTGGAAAAGTATTAATGAAGCTTAGAAAACCTAGAATTACAGCTACAATTTGGTCCTCAGGAAAAATTATTTGCACTGGAGCAACAAGTGAAGAAGAAGCTAAATTTGGTGCCAGACGTTTAGCTCGCAGTCTCCAAAAACTAGGTTTTCAGGTAATATTTACAGATTTTAAGGTTGTTAACGTTTTAGCAGTATGTAACATGCCATTTGAAATCCGTTTGCCAGAATTCACAAAGAACAATAGACCTCATGCCAGTTATGAACCTGAACTTCATCCTGCTGTGTGCTATCGGATAAAATCTCTAAGAGCTACATTACAGATTTTTTCAACAGGAAGTATCACAGTAACAGGGCCCAATGTAAAGGCTGTTGCTACTGCTGTGGAACAGATTTACCCATTTGTGTTTGAAAGCAGGAAAGAAATTTTGTAATTCATCACTTAATTGGTTAGAATCCCTAACTGAGCACCTTTTAAAACCTGCTGCACATTGGACTCAAAACAGAAGGAAAACTGGACCAACAGCAATCGAGGAAATAGACTCTTATTCTTTCATGGCTGCAGTGTAAGCTCCAGGCCCTTTGGGTTTTATTTCAAACCTTGCTGTAATATAAAAAGGAAGTTTACAAGACATGACGTTGCTGCTTTTACAAAAGGACATTCTATTTATTTTTGCAGTAATTCTCATGTCCCCATAAGCAGAGCTGTCACAGTGTGCACTACCTTAAATTGTTTAGTTGTTATTTTTTTCCAGTTTGAGCTAATGTGTTTTATTTGTGAATAGTCTTTTACATTTTTGTATGCTGAATATGGGCACCAAAGAACCTGTAAAAGTTATCTTTTTCAATTGAATGTGCACAAATAAAAGTTTGGAAAAGGTCTCTCTTCATATCCATTCTGTAACTTTTATTCCCCATTTTCTATTTTAATAAAAATTGTATTCATAATTCTTTTTTTAATCTATGCAAGCT