Transcript asmbl_39364

Sequence
Transcript Sequence for observation asmbl_39364 of TGE0005303:
GGGTGACCTGGCCAAGAAGAAGATCTACCCCACCATCTGGTGGCTGTTCCGGGACGGCCTTCTGCCCGAAAACACCTTCATCGTGGGCTATGCCCGCTCACGTCTCACGGTGGCCAATATCCGCCAGCAGAGCGAGCCCTTCTTCAAAGCCACCCCTGAGGAGAAGCCCAAGCTGGAGCAGTTCTTTGCCCGCAACTCCTACGTGGCTGGCCAGTACGACGACGCAGCCTCCTATCAGCGTCTCAATAGCCACATGAACACCCTCAACCAGGGGTCAAAGGCCAACCGCCTCTTCTACCTGGCCTTGCCCCCCACTGTCTATGAGGCTGTCACCAAGAACATCCGAGAGAACTGCATGAGCCAGACAGGCTGGAACCGCATCATTGTGGAGAAGCCCTTTGGGAAGGACCTGCAGAGCTCCGACCAGCTGTCCAACCACATCTCCTCCCTGTTCAGCGAGGACCAGATCTACCGCATCGACCACTACCTGGGCAAGGAGATGGTCCAGAACCTCATGGTGCTGAGGTTTGCCAACAGGATCTTCAGCCCCATCTGGAACCGGGACAACGTTGCCTGCGTCATCCTCACCTTCAAGGAGCCCTTCGGTACTGAGGGCCGTGGGGGCTACTTCGATGAATTTGGGATCATCCGGGATGTAATGCAGAACCACCTCCTGCAGATGCTGTGTCTGGTGGCCATGGAGAAGCCCGCCTCCACTGACTCGGATGATGTCCGAGATGAGAAGGTCAAGGTGTTGAAATGTATCTCAGAGGCAAAGGCGAGCAACGTGGTCCTGGGCCAGTATGTGGGGAACCCCGACGGAGAGGGCGAAGCCACCAAAGGCTACTTGGACGACCCCACAGTGCCCCGTGGGTCCACCACCGCCACCTTTGCAGCTGTGGTCCTCTATGTGGAGAACAAGAGGTGGGACGGGGTGCCCTTTATCCTGCGTTGCGGCAAAGCCCTAAATGAGCGCAAGGCCGAGGTCCGCCTGCAGTTCCGAGACGTGGCTGGCGACATCTTCCAACAGCAGTGCAAGCGCAACGAGCTCGTGATCCGCGTGCAGCCCAACGAGGCTGTGTACACCAAGATGATGACCAAGAAGCCCGGCATGTTCTTCAACCCCGAAGAGTCGGAGCTGGACCTGACCTATGGCAACAGATACAAGAATGTGAAGCTCCCTGACGCGTACGAGCGCCTCATCCTGGACGTCTTCTGTGGGAACCAGATGCATTTTGTGCGCAGTGACGAGCTCCGGGAGGCCTGGCGGATCTTCACACCGCTGCTGCATGAAATCGAGGGCAAGAAGCTCCAGCCCATCCCCTATGTTTACGGCAGCCGAGGCCCGGCGGAGGCAGACGAGCTGATGAAAAGAGTGGGCTTCCAGTACGAGGGCACCTACAAGTGGGTGAACCCCCATAAGCTCTAAGCCCCGGGCGAGCCCACCCCGTCTGTCCGCCCTCCCCACCTTCCCAGCACCTGCCCCCACGTCGAGAAAACTTCGGGACCATAGACCTCAGCCTCGCATTCCTGGCCCCGGGCCCAGCAACATTCCTCTACCACTGAGCACTTGACACTCGTGCTGTGACCGTCCCCAGCCACCACTGGCCCTGTCCGAGCCAGCTTCTGTCCACAGGGCTGAGCCCCAATGGAAGGAAAGAGAAGAATGGCCCTTCTGTCTGTCCCAGGGTCCTTGGCCTAGGACAGGAGTTAAGGGCGAGGGGGAGGACCAGGGGTGGGCTTCAGCGGGCCAGTGGCCAACGCACACACCCAGGGGCTGTGGTCAAGCCCCTCAGAACCTGGGGAAAGGGAGCAAACGTGTCCACACCAGCCTCAGCACTACTGTACATTCCTGGTCACCCACTGAAGGGACTTCTGTGCCGCCAGCAATCCCCTATGTATTGGGCCCTCTGAACGTCCCTCTGCCCCGCCCGCTGCCCCCACCAGCCCAACTCTGCACTCCATGGCCCACCCAACCCACAGGTGCCCCCCTCGCTATTAGAAAAGCAGAAGCAGCAGGTGGGACACCCCACCTCAGCTCCCTGCCATTAAATATGTAAACAGA