Transcript asmbl_39334

Sequence
Transcript Sequence for observation asmbl_39334 of TGE0005296:
GCCGGAGTGAGAGAGTTTGGCGGCAGTAGCGGGGCGTGTGAGGTGTCGGTGGGAGGCTCGGAAACAAGCTCACTTCTCCCTGTTGGAAATCCAGCAACAGGATGAGTCTGCAGTGGACTGCAGTTGCCACCTTCCTCTATGCAGAGGTCTTTCTCGTGCTGCTTCTCTGCATTCCCTTCATTTCACCCAAAAGATGGCAGAAGATTTTCAAGTCCCGCCTGGTGGAGTTCGTAGTGACCCATGGCAACACCTTCTTTGTGGTTCTCATTGTCATCCTTGTGCTGCTGGTCATTGATGCTCTGCGTGAGATTCGGAAGTATGATGACGTGACAGAGAAGGTGAATCTCCAGAACAACCCTGGGGCCCTGGAACACTTCCACATGAAGCTTTTCCGTGCCCAGAGGAATCTCTACATTGCCGGCTTTTCTCTGCTGCTGTCCTTCCTGCTTAGACGACTGGTGACTCTCATCTCCCAGCAGGCCACTCTGCTGGCCTCCAATGAAGCCTTTAAAAAGCAGGCAGAGAGCGCTAGTGAGGCGGCCAAGAAGTACATGGAAGAGAATGACCAGCTGAAGAAGGAAGCTGCTGTCGGTGGCGTTGAGTTGAGTGCCAGGGAGGTGACTTTGGAGTTAGAGACCAGTAACCTGAAGGCCGATCTGAAGAAGCTGAAGGATGAGCTGGCTATAAACAAGCAAAAACTAGAGAAAGCTGAAAACGAGGCTCTGGCCATGCGGAAGCAGTCCGAGGGCCTGACCAAGGAGTACGACCGCCTGTTGGAGGAGCACACGAAGCTGCAGGTGGCAGTAGATGGTCCCACGGACAAGAAGGAGGAGTGAGGGCCCCTCCCGCCCGTGGCCTGGCCTGAGCTCGAGCTCGCCACTTCCCGAGAGCCAGGCCTCTCTGGGCACTTGCACTTCCCACCCCTCACACTGCCTACAGTTCATTGTTCTCCCAGCGCCCCCCAGAGGACCGGGCTCCCACCTACTCAGGATGCATTTGTCACCAGCTTGGCTATCCAGGAGCATGGTGGGCCCCTGGAACCCTCGTGATGGGTCTTGCTTCTTGCTGGGCGGAGCCCCTTTTTTTGTTGCACGTTGATGTTTGGGCTCCAAGTCCCCTTTTCTCTGCTCCTGCAGGAGGGTGGGCGAAGCAGGCAGAGTTTCTGTTGGGGGCAATAAAGGTTATTATGATGTG