Transcript asmbl_39012

Sequence
Transcript Sequence for observation asmbl_39012 of TGE0000454:
GATGGCTGAAACAGAGTCGGTATCTGCTCTAGCTGCCGGAAATATGTGAGCCTCTATGGTCTAAAAGGCTCTTTCGCGGTGCGTTTCTGACGACTTCCGGCGGCTCTTCTCGCGGGTATTGGCTGTTGGCGGCGTTGTGGCTAAGCTCGTGTGCGGCGGCAGTGTCGGCGGCGGCTGCAGCGAAAGAGTTTGGCGCGATGTCTCACACCATTTTGCTGGTACAGCCTACCAAGAGGCCAGAAGGCAGAACTTACGCTGACTATGAATCTGTGAATGAATGCATGGAAGGCGTTTGTAAAATGTATGAGGAACATCTGAAGAGAATGAATCCCAACAGCCCCTCTATCACGTATGATATCAGTCAGTTGTTTGATTTTATTGATGATCTGGCAGACCTCAGCTGCCTTGTTTACCGAGCTGATACCCAGACATACCAGCCTTATAACAAAGACTGGATTAAAGAGAAGATCTACGTGCTCCTTCGTCGGCAGGCCCAGCAGGCCGGGAAATAGTTGTATTGGAAGGGGATGGGAGTGGGGTGGAACACAGGTGTGTACAGCGTGCTGTAGTGGAAGTTTTGTATTATAGTAATCCTGTTTCCATTTTGGTACACTCTAGCCAGGATCGAATGTATTAGATGAAATGTGAGGATCTTGTTCAATCTGAAACCCCTGTCACCCCCTTTTTTTTCTTTCTTTCCTTTTTTTTACTTAAATATTTTTATGATTATTTAGATGGAAGTTGTTCTTTGTCAGATAATGTTGATTCCAATCCTTCAAAAACTCTTCATATCTGCTATATAACATTCACTGTACTAACCCTTCTTCAAGTTGAAGGGGGGGGTGGTGGCACAGGTTAGTTATGTCCTCAAGATACAGTCTAGTGAAAAACAAATAAATGTTCTTTAGTTATA