Transcript asmbl_38957

Sequence
Transcript Sequence for observation asmbl_38957 of TGE0005280:
GGTGTGGTTCGGGCTTTCTGCGGGCGGGTACCGTGACTCCGGAACAGGGGAGTCGGGGGAGGGGGAAGGGAGTTTGGCTCGCGCGGCTCTCCCCTCGGCTGGCTCCACCGCCGCCATTTTGTGGCTGCCTAGCGTCCGCCCGTGGCCGTCTGCGCAGGCGCGGCCGTGGCGTCGCGAGAATCCGGCTTCCACCCGCTGTGACGCTCCTGGGAGGCGGCGAAGCGCTCGGCCCGTCGCCATTGGGCTGGCCTTGCGGAGGGCGGGGCCGGCTCCACCCGCACTTCTCGGCCTTTCCTAACTGCGGCAGATGGGAGGGGGCCAGAAGAGCCGGGGAGAGTGAGGCTGCGCAGTTCCAGAGGCGGCAGTGGGCGTTGCGGTTGCTGCGTTCTGGGCCCAGGGAAGGATCGTGTTGGGAGCCGAGTTTTAATTTTGTCTGCAAGGGACCTGGCCTAATAAGAGGCACTCTTGGCAATCTTGTTTATAACATCACCCGGGAATACTAGCCGGGCGTCATGAGTGGCTGTCGGGTATTCATCGGGAGGCTAAATCCAGCGGCCAGGGAGAAAGACGTGGAAAGGTTCTTCAAGGGGTATGGACGAATAAGAGATATCGATCTGAAGAGAGGCTTTGGTTTTGTGGAATTTGAAGATCCCAGGGATGCTGATGATGCTGTATATGAACTTGATGGAAAAGAACTTTGCAGTGAAAGGGTTACTATTGAACATGCTCGGGCTCGATCTCGAGGTGGCAGAGGTAGAGGACGCTACTCTGATCGTTTTAGTAGTCGCAGACCTCGAAATGATAGACGAAATGCTCCTCCTGTAAGAACAGAAAATCGGCTTATAGTTGAAAATTTATCTTCAAGAGTCAGCTGGCAGGATCTTAAAGATTTCATGAGACAAGCTGGGGAAGTAACCTTTGCGGATGCACATCGACCTAAATTAAATGAAGGGGTGGTTGAGTTCGCCTCTTATGGTGATTTAAAGAATGCTATTGAAAAACTTTCTGGAAAGGAAATAAATGGGAGAAAAATTAAATTAATTGAAGGCAGCAAAAGGCACAGTAGGTCACGAAGCAGGTCTCGTTCCCGGACCAGGAGTTCCTCTAGGTCTCGTAGCCGATCTCGCTCTCGGAGTCGCAAGTCTTACAGCCGGTCTAGGAGCAGGAGCCGGAGCCGGAGCAAGTCCCGTTCTGTTAGTAGGTCTCCTGCACCTGAGAAGAGCCAGAAACGTGGTTCTTCAAGTAGATCTAAGTCTCCAGCATCTGTGGATCGCCAGAGGTCCAGGTCTCGGTCCCGGTCCAGGTCCAGATCAGTTGACAGTGGCAATTAAACTGTGAATAACTTGCCCTGGGGGCCTTTTTTAAAAAACACACAAAAATTCCCAAACCATACTTGCTAAAAATTCTGGTAAGTATGTGCTTTTCTGGGGAGAAGGGGGGTGGAATTTGGAGGGGGGTTGGGTTGGGCTGGATTATCTTT