Transcript asmbl_37543

Sequence
Transcript Sequence for observation asmbl_37543 of TGE0005218:
GACCCCTTTGCTGATGCAACTAAGGGTGACGACTTACTCCCGGCAGGGACTGAGGATTACATCCATATAAGAATCCAGCAACGGAACGGCAGGAAGACACTGACCACTGTTCAGGGCATCGCAGATGATTATGACAAAAAGAAACTTGTGAAAGCTTTCAAAAAGAAATTTGCCTGTAATGGTACTGTGATTGAACATCCTGAATACGGAGAGGTTATTCAGCTTCAAGGTGACCAAAGAAAAAACATTTGCCAATTTCTGTTGGAGGTTGGCATTGTCAAGGAGGAACAGCTTAAGGTTCATGGATTCTAAAATGAACCTAGATACGTGGAGAATTTCTTGAATAATTTTGTTCTCTAAATCCAGTTTGGCTGCCTTGTGAAATGATTCTCTGCAGTAAACGGACTTTTCATTTATTTAATCATTCAGATTTCCATTTACATCTGCATGACTACAGAAAACATGGGGTATGTAGGCTAGTAACACATAAGAAAATTGCAGTAAGATGGTAATGAAACCCCGTATTCATCTTAACATGTTTCCAATGGAAAATATTTTGTTTTGAGTGTTTATTTGTTTATTGTTCAGTTTATTACTTTTCACTTGATTAAATGTTTTTTTGTTGTATTAAACCATGTATGTTGCAGCTTAACAATAAAAATATGAATTCTTTTGTGAGCAGTTAGGCTCCCAAATTTAAGCAAGTAAGATACCCATACATTTTGTCTTTCATAATTGGAGTTCTCATTCTGAAAGTATTCTAATTAGATTCAGCTGCTGTTAAACCCAAAGCTAGAAGAGAACCTTTGTTAAAAGTAGCTTGTGTTCTTCATTTACTGACTTAAAATAAGAATAGAATCGCGTATAAACTCAGCTAGAGCCAAG