Transcript asmbl_37274

Sequence
Transcript Sequence for observation asmbl_37274 of TGE0005201:
GGCGCTTCCTGTTTCCGGTTCCCAGAGTGGAGCACCGCGAGGCGCTGAGGGGAACGCTGGCTGTGACACGAGCTCTGGGACTGGGGTCTGTGGCTGGCCCCTCGCTGGCCCTGTCTCCCAGCCCCAGACAGGTACTCACCTGGGGAGTCTGAGCTTTGGCTACTCCCTTTGCCCGTGACACGATGTTCCCCTTCTACAGCTGCTGGAGGACTAGATTACTGCTGCTGCTACTGCTGGCTGTGACGGTGAAAGAATCCTGGCAGGCAGAAGAGAAAACCTGTGACCTGGTAGGAGAAAAAGGTAGAGAGTCAGAGAAAGAGTTGGCTCTACTGAATAGGATGAAACCACTGTATAACAAAAGCTTTGAGAGCACTGTGGGCCAGGGCCCAGACAAGTATATGTACATATTCAGAGTGTGCCGAGAAGCTGGCAACCACACCTCTGGGGCAGGCCTGGTGCAGATCAATAAAAGTAATGGGAAGGAGACAGTGGTGGGGAGACTCAACGAGACTCACATCTTCAATGGAAGTAATTGGATCATGCTGATCTATAAAGGGGGTGATGAATATGACAATCACTGTGGCAGGGAGCAGCGCCGTGCAGTGGTGATGATCTCCTGCAATCGACACACCCTAGCGGACAATTTTAACCCTGTGTCTGAGGAGCGAGGCAAAATCCAAGATTGTTTATACCTCTTTGAGATGGATAGTAGCCTGGCCTGTTCTCCTGAGATCTCCCACCTCAGTGTGGGTTCTATCTTACTTGTCACGTTTGCATCTCTGGTTGCTGTCTATATCATCGGGGGGTTCCTATACCAGCGACTGGTGGTAGGAGCCAAAGGAATAGAGCAGTTTCCTCACTTAGCCTTCTGGCAGGATCTTGGCAACCTGGTAGCAGATGGTTGCGACTTCGTGTGCCGTTCTAAACCTCGAAATGTGCCTGCTGCATATCGTGGTGTGGGGGATGATCAGCTGGGGGAGGAATCAGAAGAAAGGGATGATCATTTATTACCAATGTGATTGCACTTTAAATGCCCAGCTTCTTCAGCCCCCCGCCCAGACCAAAGCATACTCAGCCAGATTTCTGAAGCAATCTCTCTACTCCAGTCTCTCCTCTCACCCTTAATGTTGCTCTTGCTTTCCAGTTTGCTTTTGGTTTGCATCCTCTTCTCACTAGTTGATATGCCTTCCCTTTTTCCTTATTTTTGGTTTTTCCTCAAGAGGTAGAGTTGTAGGTCAGAGGTTAACAGGGCCAGTGACAAGAGGCTATTGCACTGTCTTGGTACAGGAGGGTACAGTTAGGATCATTTTAATGAGCAAAAGCATGTGGCAGGCTTGCTGACCCTTTTTTAAACACATTTTCACAAGTTCTTGAGACACTGGATTTCT