Transcript asmbl_37076

Sequence
Transcript Sequence for observation asmbl_37076 of TGE0005159:
GGTAAGAATGATGGGGAAAGTGACCAGAACACATTCGTTTCTCACCCAGAATTGGCTCCTTCTCCTTCCTAGAACACAGCCCTGGGCTGTGGGGGCCATGGAGTATTTGGGTTCCTTGGGGTTGGCTCAAGTCACTTTATCCCTTAATTTCTCCCAAAGGTGAGGAGGGAGGTTGAAGGGCAGGTGAGGAGCACTCTGTTTGGCCTTCACTCCCTTTTCCATGTTTCCAGACCACAGTCCACGCCATCACTGCCACCCAGAAGACCGTGGACGGCCCCTCTGGGAAGCTGTGGCGTGATGGCCGAGGGGCTGCCCAGAACATCATCCCTGCTTCTACTGGCGCTGCCAAGGCTGTGGGCAAGGTCATCCCTGAGCTGAATGGGAAGCTTACTGGCATGGCCTTCCGTGTCCCTACCCCCAACGTGTCAGTTGTGGATCTGACCTGCCGCCTGGAGAAAGCCGCCAAATACGATGACATCAAGAAAGTGGTGAAGCAGGCGTCGGAGGGTCCCCTCAAGGGCATCCTGGGCTATACTGAAGACCAGGTTGTTTCCTGTGACTTTAACAGTGATACCCACTCTTCCACCTTCGATGCTGGGGCTGGCATTGCCCTCAATGACCACTTTGTCAAGCTCATTTCCTGGTATGACAATGAATTTGGCTACAGCAACAGGGTGGTGGATCTTATGGTCCACATGGCCTCCAAGGAGTAAGAGCCCCCTGGACCACCAACCCCAGTGAGAGGAAGAGGCCCTCAGCTCCTGGGGAGTCCTTGCCCCAAATCGATCCCCCAGCATACTGAGTGAGAATCTGACCTCCAGTTTCCATCCCAGACCCCCTGAAGAAGGGGAGGGGCTTAGGGAGCCCTACCTTGTCGTACACCATCAATAAAGTTCACTGTACCCAGCCAA