Transcript asmbl_37075

Sequence
Transcript Sequence for observation asmbl_37075 of TGE0005158:
CGTAGCTCAGGCCTCCGCGCCCTTGGGCTGGGACTCCACAGGCTGGCGGGAGGCTGGTCGCGTCACCCACGCCCCCGCCGCGCCCCGTTTCTATAAATTGCGAGCGCAGCCTCCCCCAGCGCTCTCTGCTCCTCCCGTTCTACAGACAGCCGCGTCCTCCTGCGCAGTGCCAGCCGCGACCCTGAGACACGATGGTGAAGGTTGGAGTGAACGGATTTGGCCGTATTGGGCGCCTGGTCACCAGGGCTGCTTTTAACTCTGGCAAAGTGGATATTGTCGCCATCAATGACCCCTTCATTGACCTCAACTACATGGTCTACATGTTCCAGTATGATTCCACCCATGGCAAGTTCAAAGGCACAGTCAAGGCTGAGAATGGGAAGCTTGTCATCAATGGAAAGCCCATCACCATCTTCCAGGAGCGAGATCCCACCAACATCAAATGGGGTGATGCTGGTGCTGAATATGTTGTGGAGTCCACTGGTGTCTTCACTACCTTGGAGAAGGCTGGGGCTCACTTGAAGGGTGGAGCGAAGCGGGTCATCATTTCTGCTCCTTCTGCGGATGCCCCCATGTTTGTGATGGGTGTGAACCATGAGAAGTATGACAACTCCCTCAAGATTGTCAGTAATGCCTCCTGCACCACCAACTGCTTGGCCCCCCTGGCCAAGGTCATCCATGACAACTTTGGCATTGTGGAAGGACTCATGACCACAGTCCACGCCATCACTGCCACCCAGAAGACCGTGGACGGCCCCTCTGGGAAGCTGTGGCGTGATGGCCGAGGGGCTGCCCAGAACATCATCCCTGCTTCTACTGGCGCTGCCAAGGCTGTGGGCAAGGTCATCCCTGAGCTGAATGGGAAGCTTACTGGCATGGCCTTCCGTGTCCCTACCCCCAACGTGTCAGTTGTGGATCTGACCTGCCGCCTGGAGAAAGCCGCCAAATACGATGACATCAAGAAAGTGGTGAAGCAGGCGTCGGAGGGTCCCCTCAAGGGCATCCTGGGCTATACTGAAGACCAGGTTGTTTCCTGTGACTTTAACAGTGATACCCACTCTTCCACCTTCGATGCTGGGGCTGGCATTGCCCTCAATGACCACTTTGTCAAGCTCATTTCCTGGTATGACAATGAATTTGGCTACAGCAACAGGGTGGTGGATCTTATGGTCCACATGGCCTCCAAGGAGTAAGAGCCCCCTGGACCACCAACCCCAGTGAGAGGAAGAGGCCCTCAGCTCCTGGGGAGTCCTTGCCCCAAATCGATCCCCCAGCATACTGAGTGAGAATCTGACCTCCAGTTTCCATCCCAGACCCCCTGAAGAAGGGGAGGGGCTTAGGGAGCCCTACCTTGTCGTACACCATCAATAAAGTTCACTGTACCCAGCCAA