Transcript asmbl_27355

Sequence
Transcript Sequence for observation asmbl_27355 of TGE0000992:
TCCAAGATGGCGGGATCCAGGCAAAGGGGTCTCCGGGCCAGAGTTCGGCCGCTGTTCTGCGCCTTGCTGCTGTCACTCGGTCGCTTCGTCCGGGGCGACGGCGTGGGAGGAGACCCCGCGGTCGCGTTGCCACATCGCCGTTTCGAGTACAAATACAGCTTCAAGGGGCCGCACCTGGTGCAGAGCGACGGGACCGTGCCCTTCTGGGCCCACGCGGGGAATGCTATTCCAAGTTCAGATCAAATTCGAGTAGCACCATCTTTAAAAAGCCAAAGAGGCTCAGTGTGGACAAAGACAAAAGCGGCCTTTGAGAACTGGGAAGTTGAGGTGACATTTCGAGTGACTGGAAGAGGTCGAATTGGAGCTGATGGCCTAGCAATTTGGTATGCAGAAAATCAAGGCTTGGAGGGCCCTGTGTTTGGATCAGCTGATCTGTGGAATGGTGTTGGAATATTTTTTGATTCTTTTGACAATGATGGAAAGAAAAATAATCCTGCTATAGTAATTATAGGCAACAATGGACAAATCCATTATGACCATCAAAATGACGGGGCTAGTCAAGCTTTGGCAAGTTGCCAGAGGGACTTCCGCAACAAACCCTATCCTGTCCGAGCAAAGATTACCTATTACCAGAACACACTGACAGTAATGATCAATAATGGCTTTACACCAGATAAAAATGATTATGAATTTTGTGCCAAAGTGGAAAATATGATTATCCCTGCACAAGGGCATTTTGGAATATCTGCTGCAACTGGAGGTCTTGCAGATGACCATGATGTCCTTTCTTTTCTGACTTTCCAGTTGACTGAACCTGGAAAAGAGCCGCCCACACCAGATAAAGAAATTTCGGAAAAGGAAAAAGAAAAGTATCAGGAGGAATTTGAGCACTTTCAACAAGAATTGGATAAAAAAAAAGAGGAATTCCAGAAGGGCCACCCCGACCTCCAAGGGCAGCCTGCGGAGGAAATATTTGAGAGTGTAGGAGATCGAGAGCTAAGACAAGTCTTTGAAGGACAGAATCGTATTCATCTTGAAATCAAGCAGCTGAACCGGCAGTTAGATATGATTCTTGATGAACAGAGAAGATATGTCTCTTCCTTAACAGAGGAAATCTCTAAAAGAGGAGCAGGAATGCCTGGGCAGCATGGGCAGATTACTCAACAAGAACTGGATACTGTTGTGAAAACTCAGCATGAGATTCTGAGACAAGTAAATGAAATGAAAAATTCCATGAGTGAAACCGTCAGACTGGTCAGTGGAATGCAGCACCCTGGCTCTGCTGGAGGCGTCTATGAGACAACACAGCACTTCATTGACATCAAAGAGCACCTGCACATAGTAAAGAGGGACATAGATAACTTAGTGCAGCGAAATATGCCATCAAATGAAAAGCCGAAATGCCCAGAACTACCACCATTTCCATCATGTTTGTCTACGGTCCACTTCATTATATTTGTTGTGGTGCAAACTGTATTATTCATTGGTTATATCATGTATAGGTCTCAGCAAGAAGCAGCTGCCAAAAAATTCTTTTGACTACCATTTTCCTGTGTACTTCATCTATTTGTGTACAAAATGATGTCGTTTTGAGGGAATTTAAGTATTTAAATT