Transcript asmbl_36179

Sequence
Transcript Sequence for observation asmbl_36179 of TGE0005109:
NNNNNCTAGGGCGTCGGACCGGAGCCGGCTGGTGTGCGGGCGACCCAGTGGAGCTGGCCTGACCTTGGGGACTTTGGCTATCCTAGGAGAATCCAGTTCTCAGCCCACCAGGAGCCGAGGCAATGGCCTCAAAACCTGAGAAGCGCATCGCCTCGTCTGTCTTTATCACCCTGGCACCCCCACGTCGACACGAGGCTGTGGCTGAGGAAGTGAGGCGGGCAGCTTGTGAGGCCCGGCCCGGCCGCACCAGGGAGTCTTCCGCCCCCATGAAGGCAGCCGGGGCCGGCTCAGCAGAGAGGCCCAGTCTCTGGACGGCCCCCGGCAGGGCCGCAGCCCCGGTGCCAGCTGTGCCGCCTCAGCTCTCCAATGGAGGATGCTCTCTTCCTCCTCCAGCCCTGGATGGCGAGGACGCACTCCCCGACCTGGACCTCCTCCCACCTCCGCCGCCGCCCCCACCCGCATACCTGCCACCTTGCGATGACCAGCCTCCAGCCTCAATGGGGGCGTCACTCATTTCAGATTTAGAGCAGCTGCACCTGCCCCCGTCCCCACCACAGTCCCTGGCGGAGGGGGCTCCATTCCAGCCTCAGCCCGGTCATCTCAGGCCTGCGGAGGAGAAGTTGCCGCCTCCCCCAGCAGAGCCTGTTGGCTTGGCTGAGAGAGAGGCATCCACAGACATCTGTGCCTTCTGCCACAAGACCGTGTCCCCCCGAGAGCTGGCCGTGGAAGCCATGAAGAGGCAGTACCACGCCCAGTGCTTCACGTGCCGCACCTGTCGCCGCCAGCTGGCCGGGCAGAGCTTCTACCAGAAGGATGGGCGGCCCCTCTGCGAACCCTGCTACCAGGACACCCTGGAGAAGTGTGGCAAGTGTGGTGGGGTGGTCCAGGAACACATCATCAGGGCCCTGGGCCGGGCCTTCCACCCAGCCTGCTTCACGTGTGTGACCTGTGCCCGCTGCATCGGGGACGAGAGCTTTGCCCTGGACAACCAGAATGAGGTGTACTGCCTGGATGACTTCTATAGGAAATTTGCCCCTGTGTGCAGCATCTGTGAGAATCCCATCATCCCCCGAGATGGGAAGGATGCCTTCAAAATCGAGTGCATGGGAAGAAATTTCCATGAAAACTGCTACAGGTGTGAGGACTGCAGGATCCTCCTGTCCGTGGAGCCCACGGACCAAGGCTGCTACCCCTTGGACAACCGTCTCTTCTGCAAGCCATGCCATGTGAAGCGGAGTGCCGCAGGGTGCTGCTGAGAGCCCCACCAGGCCCTGGGGCCCTGAGCCACCCACTGGCCCTGGTCAGGAGGGGGGGATCCTCCCTGCCTCGGTTTCCCTTCCTGACCTGCTCTTGCACACTTTCCTTCCTAGCCACGAGGACCAGCCCGTCATGTCTGTGACCCCAGCTCAGGAGTGGGTGGCAGGCAGAAGGTGCCTCTCAGAATTTTGCCTCCTCCTCTCCCCTGGGCGTAGGAAGTCTTCATGCGTGAGTGTCGCACCCTAGGTGTGCGCTCTGAGCTCTGAGCCTCTGGCCCCTCTTGAGCGCTGGCCTTGACCCCATTTCCAGGGGTGAGTCGGGGCGAGTCTCTGGGAGGCACCCTGTGTCCCTAGCAATGACACTTTCATTGTCCCGTATGAGGTGCTGAGATCAGCTCTGCCTTGCAGGACTGAGCTGTTTGAGTAAAACTCCAAGGTCCCTTAAAAAGCACTTTTAAAAAAAAAGTGAGGTTTAAATGATGGGGCACATTTTTTGTATTTTTGGGGGGGTCAGTCTTAATAGGTAATGTCTTCCATGCGTTCATAAATGTACAAGAAGGTGACCTGGTTTTGGCACAGCCATGGACTTCTCAGCTGGGTGACGTGGAGCCCGGGACCAGCTGTAAACCCAAGGAGCAGAGGCAGGAGGGGAGTGCGAGGTATGGGACAGGCAAGGCAGCCTCTCCACCCTGCCCCCTGGCGCTCCTCCTGCATGCAACAGTGAGTCAACAGACATTAAGTACCTGGTGTATGCTGGGAACAAGGTGCAGGAGCTCTGAGTGTTCTTCCTGCAGCCTTGACTGGGGCCGTGCCACACCCCCAAGCCACACGCACACGCGCCCCTCCAGGACAGTCCCTCGGTTATCCCCCTAAGTTCCCACTTGGGCCCTTCTGCCCAGGCAGCCCCGTGACCACTGCCTCCTCAAGGCCACACCTAGAGGAGACGTCTTTCCTTTTAAGGAAAATCACTTTCTTTGCTTTGTAACTTCTAGACATTTTCAGGGCATGGACCAATGTCCATGCAAGATGTGCTGTCCTCCCTGCAGCCGTCTCAGTGTCCCACCCACTCCTCTGAGCATGCCCGCCTCCACAGACTGGGGGTGCTTCTCCACGGAACCCCTCAGGGGCTGCAGACCAGAGTATGGCTTCCTGCCCAAAGCTTAGAGCAGCGAGTCCCCAAACCAGGCATTCACATACCATCTACACAATTTTTGTCCTAACCAAGGACCTCCTATTCTCGTATTTCCTTAACATTGTCTTTAAACCAACATACTTTTAAAGATTCACTTCCAGCTGTAGTCTTGTGCTAAGCAATATAGCTATGCGGTCACATGTTGATGTGCTAGTTATGTTTTTTCCTATCACACATGAAAATAAATGCATAACTATTAGAAGTCCATCTGTGTTCCATCTAAGATCTCGCCTAGGTAAACTCAGGCCCTTGGTAGAGCCCTCGAAACGTGCTCACTGGGCCTCTGTTCACAGTGGAACAAGTGCCCAGTGCCTGCACCTCCTTCCTCCCAAACTGGGGCTCAGCTCAGCAGATCAGGAAACTTATGGCCTTACAAAGATTTGCACCGGTCAAC