Transcript asmbl_36120

Sequence
Transcript Sequence for observation asmbl_36120 of TGE0005119:
AGGAAACTTGAACGTAACTTCAAAAGAAGATTTGATTTTTTTGTATCTGGATCACGTATATACAGCAAGACCGTCAGAATGTCGGGAGCCTCAGTGAAGGTGGCTGTCCGCGTGCGGCCCTTCAATTCTCGAGAGACCAGCAAAGAGTCCAAGTGCATCATTCAGATGCAAGGCAACTCCACCAGTATTGTTAACCCAAAGAACCCAAAGGAAGCTCCAAAGTCCTTCAGCTTTGACTACTCCTACTGGTCTCACACCTCGCCAGAAGATCCCTGTTTTGCATCTCAAAACCGAGTGTACAATGATATTGGAAAGGAAATGCTCTTACATGCTTTCGAGGGATATAATGTCTGTATTTTTGCCTATGGGCAGACTGGTGCTGGGAAATCTTACACGATGATGGGTAAACAAGAAGAAAGCCAGGCTGGCATCATTCCACAGCTGTGTGAAGAACTATTTGAGAAAATCAATGACAACTGTAATGAAGACATGTCTTACTCTGTAGAGGTGAGCTACATGGAAATTTACTGTGAAAGGGTACGCGATTTGCTGAATCCAAAAAACAAGGGTAATTTGCGCGTGCGTGAGCACCCACTTCTTGGCCCGTATGTGGAGGATCTGTCAAAGTTGGCAGTCACTTCCTACACAGACATTGCTGACCTCATGGATGCTGGGAACAAAGCCAGGACAGTGGCAGCTACCAACATGAATGAAACAAGTAGCCGTTCCCACGCTGTGTTTACAATTGTTTTCACCCAGAAGAAACATGACGCCGAGACCAACCTTTCCACTGAGAAGGTCAGTAAGATCAGCTTGGTGGATCTAGCGGGAAGTGAACGAGCTGACTCAACTGGTGCCAAAGGGACTCGATTAAAGGAAGGAGCAAATATTAATAAGTCTCTTACAACTCTGGGCAAAGTCATTTCAGCCTTGGCAGAGGTGAGTAAGAAGAAGAAGAAAACTGATTTTATTCCCTACAGGGATTCTGTACTTACTTGGCTCCTTCGAGAAAATCTAGGTGGCAATTCTCGGACTGCCATGGTTGCTGCCCTGAGCCCAGCAGATATCAACTATGATGAAACTTTGAGCACTCTGAGGTATGCAGATCGTGCAAAGCAGATTAAATGCAATGCTGTTATCAATGAGGACCCCAATGCCAAGCTGGTCCGTGAACTAAAGGAGGAGGTGACGCGGCTGAAGGATCTTCTTCGTGCTCAGGGCCTGGGAGACATCATCGATACGTCCATGGGGTCCCTTACTTCATCTTCATCTTCCTGCTCACTCAATAGTCAGGTGGGCTTAACATCTGTGACCAGTATTCAGGAGAGGATCATGTCTACCCCCGGAGGAGAGGAAGCCATCGAACGTCTGAAGGAGTCTGAGAAGATCATTGCTGAGTTGAATGAAACCTGGGAAGAGAAGCTGCGTAAAACAGAGGCCATCAGAATGGAGAGAGAGGCCTTGTTGGCTGAGATGGGCGTTGCCATCCGGGAAGATGGAGGAACCCTGGGCGTTTTCTCACCTAAAAAGACCCCACATCTCGTTAACCTCAATGAGGACCCACTAATGTCGGAATGCCTGCTTTATTACATCAAGGATGGACTTACAAGGGTCGGCCAGGCGGATGCCGAGAGGCGCCAGGACATCGTGCTGAGTGGGGCGCACATTAAAGAAGAGCATTGTGTCTTCCGGAGCGAGAGGAGCGACAGCGGGGATGTTATCGTGACGCTAGAGCCCTGTGAACGCTCAGAAACCTACGTAAATGGCAAGAGGGTGGCCCAGCCTGTTCAGCTGCGTTCAGGAAACCGTATCATCATGGGTAAAAACCACGTGTTTCGTTTTAACCACCCCGAGCAAGCACGGGCTGAGCGGGAGAAGACACCCTCTGCCGAGACCCCCTCTGAGCCTGTGGACTGGACGTTTGCCCAGAGAGAGCTTCTGGAAAAACAGGGGATTGATATGAAACAGGAGATGGAGAAAAGGTTACAGGAAATGGAGATCCTGTACAAAAAGGAGAAAGAGGAAGCAGACCTTCTCCTGGAGCAGCAGAGACTGGACGCGGATTCTGATAGCGGGGATGATTCTGACAAGAGGTCCTGCGAAGAGAGCTGGAAACTGATTACTTCTTTGAGAGAAAAGCTACCTCCCAGCAAGTTGCAAACCATTGTTAAAAAATGTGGCCTCCCGAGCAGTGGGAAGAAACGGGAACCAATTAAAATGTACCAGATACCCCAAAGAAGGCGCCTCAGTAAAGATTCCAAGTGGGTCACCATCTCAGACCTTAAGATTCAGGCCGTCAAAGAGATTTGCTACGAGGTGGCGCTCAACGATTTTAGGCACAGTCGGCAGGAGATCGAAGCCTTGGCCATCGTTAAGATGAAAGAGCTTTGCGCCACGTACGGGAAGAAAGATCCCAACGAGCGGGACTCCTGGAGGGCGGTGGCCAGGGATGTCTGGGACACCGTGGGAGTAGGCGACGAGAAGATCGAAGATGTGATGGCCAGTGGTAAAGGCGGAACCGACGTGGATGACCTCAGGGTTCACATAGACAAGCTGGAAGATATTTTGCAAGAGGTCAAAAAGCAAAATAACATGAAAGACGAGGAGATAAAAGTCTTAAGAAATAAAATGCTCAAAATGGAGAAAGTCTTGCCACTGATCGGGTCGCAGGAACAGAAGACCCAAGGAAACCATAAAGCGAAGGAACCTGTCGGTGCCGGCGTCAGTAGCAAGTCTGAGAATGACGTCAGTAAAGGAGACGGTGGGGAGCTTGGGTTGTTTCCCAGCTGATGAACGGGGACCCAGCTTTCCGACGTGGACGTCTGCGCTGGATGAGGCAGGAGCAGATCCGGTTCAAGAACCTGCAGCAGCAGGAGATAACAAAGCAGCTTCGTCGGCAGAACGTGCCCCATAGGTTCATCCCTCCTGAGAACCGGAAGCCCCGCTTCCCCTTTAAGAGCA