Transcript asmbl_27329

Sequence
Transcript Sequence for observation asmbl_27329 of TGE0000988:
TTTCCCTAAGCAGCCTGAGGTGAGTGTTTCTCCTGCGTTGCTCCGAGGGCCCAATCCTCCTGCCATCGCCGCCATCCTGGCTTCGGGGGCGCCGGCCTCCAGGCCCCCGGGAGGAGAACTCCTAGGGCTACTAAATCCTCGCTGGAGGCGGTGGCTTCTTATGCGGGAGGACGTGGCGGAGGGCCTGACTTTGGGAGCCGGGGTCAGTCGGCCTCTGAGGTGATCTGTGAAAATGGTTCGCTATTCACTTGACCCGGAGAACCCCACGAAATCATGCAAATCAAGAGGTTCCAATCTTCGTGTTCACTTTAAGAACACTCGTGAAACTGCTCAGGCCATCAAGGGTATGCATATACGAAAAGCCACGAAGTATCTGAAAGATGTCACTTTACAGAAACAGTGTGTACCATTCCGACGTTACAATGGTGGAGTTGGCAGGTGTGCGCAGGCCAAGCAATGGGGCTGGACACAAGGTCGGTGGCCCAAAAAGAGTGCTGAATTTTTGCTGCACATGCTTAAAAACGCAGAGAGTAATGCTGAACTTAAGGGTTTAGATGTAGATTCTCTGGTCATTGAGCATATCCAAGTGAACAAAGCACCTAAGATGCGCCGCCGGACCTACAGAGCTCATGGTCGGATTAACCCATACATGAGCTCTCCCTGCCACATTGAGATGATCCTTACGGAAAAGGAACAGATTGTTCCTAAACCAGAAGAGGAGGTTGCCCAGAAGAAAAAGATATCCCAGAAGAAACTGAAGAAACAAAAACTTATGGCACGGGAGTAAATTCAGCATTAAAATAAATGTAATTAAAAGG