Transcript asmbl_27328

Sequence
Transcript Sequence for observation asmbl_27328 of TGE0000988:
TTTCCCTAAGCAGCCTGAGGTGAGTGTTTCTCCTGCGTTGCTCCGAGGGCCCAATCCTCCTGCCATCGCCGCCATCCTGGCTTCGGGGGCGCCGGCCTCCAGGCCCCCGGGAGGAGAACTCCTAGGGCTACTAAATCCTCGCTGGAGGCGGTGGCTTCTTATGCGGGAGGACGTGGCGGAGGGCCTGACTTTGGGAGCCGGGGTGATCTGTGAAAATGGTTCGCTATTCACTTGACCCGGAGAACCCCACGAAATCATGCAAATCAAGAGGTTCCAATCTTCGTGTTCACTTTAAGAACACTCGTGAAACTGCTCAGGCCATCAAGGGTATGCATATACGAAAAGCCACGAAGTATCTGAAAGATGTCACTTTACAGAAACAGTGTGTACCATTCCGACGTTACAATGGTGGAGTTGGCAGGTGTGCGCAGGCCAAGCAATGGGGCTGGACACAAGGTCGGTGGCCCAAAAAGAGTGCTGAATTTTTGCTGCACATGCTTAAAAACGCAGAGAGTAATGCTGAACTTAAGGGTTTAGATGTAGATTCTCTGGTCATTGAGCATATCCAAGTGAACAAAGCACCTAAGATGCGCCGCCGGACCTACAGAGCTCATGGTCGGATTAACCCATACATGAGCTCTCCCTGCCACATTGAGATGATCCTTACGGAAAAGGAACAGATTGTTCCTAAACCAGAAGAGGAGGTTGCCCAGAAGAAAAAGATATCCCAGAAGAAACTGAAGAAACAAAAACTTATGGCACGGGAGTAAATTCAGCATTAAAATAAATGTAATTAAAAGG