Transcript asmbl_11270

Sequence
Transcript Sequence for observation asmbl_11270 of TGE0000097:
GGCTGTTGAGGGCGAGCCGGCGCACCGTACGCTGGGACGTGTGGTTTCAGCTCGTGCGCCTCCCCGTGGGTTTGCGACGTTTAGCGACTATTGCGCCTGCGCCAGCGCCGGCTGCGAGACTGGGGCCGTGGCTGCTGGTCCCGGGTGATGCTAGGCGGCTCCCTGGGCTCCAGGCTGTTGCGGGGTGTAGGTGGGAGTCACGGACGGTTCGGGGCCCGAGGTGTCCGCGAAGGTGGCGCAGCCATGGCGGCAGGGGAGAGCATGGCTCAGCGGATGGTCTGGGTGGACCTGGAGATGACAGGATTGGACATTGAGAAGGACCAGATTATTGAGATGGCCTGTCTGATAACTGACTCTGATCTCAACATTTTGGCTGAAGGTCCTAACCTGATTATAAAACAACCAGATGAGTTGCTGGACAGCATGTCAGATTGGTGTAAGGAGCATCACGGGAAGTCTGGCCTTACCAAGGCAGTGAAGGAGAGTACAATTACATTGCAGCAGGCAGAGTATGAATTTCTGTCCTTTGTACGACAGCAGACTCCTCCAGGGCTCTGTCCACTTGCAGGAAATTCAGTTCATGAAGATAAGAAGTTTCTTGACAAATACATGCCCCAGTTCATGAAACATCTTCATTATAGAATAATTGATGTGAGCACTGTTAAAGAACTGTGCAGACGCTGGTATCCAGAAGAATATGAATTTGCACCAAAGAAGGCTGCTTCTCATAGGGCACTTGATGACATTAGTGAAAGCATCAAAGAGCTTCAGTTTTACCGAAATAACATCTTCAAGAAAAAAATAGATGAAAAGAAGAGGAAAATTATAGAAAATGGGGAAAATGAGAAGACCGTGAGTTGATGCCAGTTATCATGCTGCCACTACATCGTTATCTGGAGGCAACTTCTGGTGGTTTTTTTTTCTCACGCTGATGGCTTGGCAGAGCACCTTCGGTTAACTTGCATCTCCAGATTGATTACTCAAGCAGACAGCACACGAAATACTATTTTTCTCCTAATATGCTGTTTCCATTATGACACAGCAGCTCCTTTGTAAGTACCAGGTCATGTCCATCCCTTGGTACATATATGCATTTGCTTTTAAACCATTTCTTTTGTTTAAATAAATAAA