Transcript asmbl_35870

Sequence
Transcript Sequence for observation asmbl_35870 of TGE0005094:
CTCTGCCTTCGCTCCTTCCGCCCAGGAAACCGGAAGTAGCCTCTCTCCCGGTGGCTCCTACGCGGTTAACGGATCCTCAGTGGACGCTGGCTGCGCGCCAAGGTAGTCAACGTGATACCTGCAGAGAGTGACTTCGGGGTTAAGGGTGGTGCTGGACGTCAGGAGCCAACATGGCAGCGGTGGTCGGAGTCTCCTTGAGGCGTCGATTCCCAGCCACAGCCTTTGGCGGAGCCTGCCTGCAGGCCTGCCGAGGGGCCCAGACAGCTGCAGCCACAGCTCCCCGAATCAAGAAATTTGCCATCTACCGATGGGACCCAGATAAGACTGGAGATAAACCTCATATGCAAACTTATGAAATTGATTTGAATAAATGTGGCCCCATGGTGTTGGATGCTTTAATCAAAATTAAGAATGAAATCGATTCTACCTTGACCTTCCGAAGATCATGCAGAGAAGGGATCTGTGGCTCTTGTGCAATGAACATCAATGGAGGCAACACGCTGGCTTGCACCAAAAGGATCGACACCAACCTCAACAAAGTCTCAAAAATCTACCCGCTTCCACATATGTATGTGATAAAAGATCTTGTTCCTGATTTGAGCAACTTCTATGCTCAGTACAAATCCATTGAGCCTTATTTGAAGAAGAAGGATGAATCCCAGGAAGGCAAGCAGCAGTATCTGCAGTCCATAGAAGAGCGCGAGAAACTGGATGGGCTCTACGAGTGCATCCTCTGCGCCTGCTGCAGCACCAGCTGCCCTAGCTACTGGTGGAATGGAGACAAGTATTTGGGGCCTGCGGTTCTTATGCAGGCCTATCGCTGGTTGATTGACTCCAGAGACGACTTCACAGAGGAGCGCCTGGCCAAGCTGCAGGACCCGTTCTCTCTGTATCGCTGCCACACCATCATGAACTGCACACAGACCTGCCCCAAGGGGCTGAATCCAGGGAAAGCTATTGCTGAAATCAAGAAAATGATGGCAACTTACAAGGAGAAGAAGGCGTCAGCTTAATTGTTCTCACACCAAACGTGACTTGCAACCAGCTCAGCTGGACATAACTTACATCTAATTTGGGTTCTTTCAGAGGTCTTCACTGTCCATGAATACAGCATGTATAATAAAACTTTT