Transcript asmbl_13981

Sequence
Transcript Sequence for observation asmbl_13981 of TGE0003178:
GTGACACACGTAGGAGCGAAAGAGCCCACTAGCTGCCCGGCAGGATTCGAATCGATCGATTTTCCGTCTGCTCTCTCTGCTGATGGTGCTTCAAAAGCTCAATTTCGTCATTAAGTAAAGTGAACGCTGCACAAGTAGGAGCGGAAATTTCTTCACCAAGTCCGGATTAGTAAATTGTTTGCGAAAAGCTCTAAACCACATTCTTCCAAACTACAATGGCCCGTACTAAGCAGACCGCCCGTAAGTCAACTGGAGGTAAGGCTCCTCGTAAGCAGTTGGCCACCAAGGCCGCTCGTAAGAGTGCCCCATCGACCGGAGGTGTCAAGAAGCCTCATCGTTACCGTCCTGGTACCGTCGCCCTGCGAGAAATTCGTCGATATCAGAAATCGACTGAGCTTCTGATCCGCAAGCTCCCCTTCCAGCGGTTGGTGCGTGAAATCGCCCAGGATTTCAAAACGGATCTCCGTTTCCAGTCGGCGGCCATCGGTGCCCTCCAGGAAGCCAGTGAAGCCTACCTGGTAGGTCTCTTTGAAGACACCAACTTGTGCGCTATCCATGCTAAGCGCGTCACAATTATGCCTAAAGACATTCAGTTGGCCCGCCGTATCCGAGGCGAACGTGCTTAAGCAGCAGGCATCTTTTGCTACTACTACTATAATTACTGTAATGATCAGCATCTCCCCTTCTCCTTCGATATATGGTATAAAATAAACCTGTATTTAATATTCAGGAACACGAAAATCACATCCAATGCATTATTGAAACCAACCAGCGAAGAGATAACACTTTCACATGAACTATAAAAATTCAAACAAAGAATCCGGATGGTGGAAATAGCAATGTCTACAAAGAGTACATTTTTTTAAATAATAGTTCGCGTTTTTGTTTTTTAGTTTTGTTCATCTTTTACCACGTAAAATGAGAAATTTAACGAAATGAAACTGATTTGTAGATTTAGTTTACGCATAAATGTGAAAGTAAAAAAAAATATTACAAAAGTAGAGATTTAAGGTAGTTTATAAGGAACAGTGTGAAGAAACAAAACACAATCAATGTTTTTGGACTATTCTGATCATTCGAATTCAGCTCGTATGAATCCTTACCCATTCAGCAACAAACTCACGTAAGAATGATTTGAAACAGTAGCTCAAAACTAAAATGCCTAGTTTTATCTGACTACGCTCCAAGTACTAAAACGATATCAGAAAAAGAGAAAGGCTAAGCAATTGATTTCTTTTAAAGAAGTTATTAGAAAATGGGTATCAATTACCCACGGAAATTATCGGTTTTGTTTCTCCCATACGTTTATAATCAAAACATAGTTTTATTTAACCAAAATTGATGCAACATTTGCAATTAACACAAACACATTTATCTATACGGAGGAAATTTGCAATTTGTCTTGAATGGAAGGTATTACAGAAGTTCAATAAATCAAACACGTCTAAATT