Transcript asmbl_35533

Sequence
Transcript Sequence for observation asmbl_35533 of TGE0005055:
AGCTGGGGACAGGAAATGATCTAAGACCTACTGGGTGTGGGGCAGAGGAGGTAGGGAACATTTGCCCTGACCTCCAGGTAAGGGGCCCTGCTCACTGGGAGACCACAGAAAGACCTAGCAAACTGGTCCTCTCCGCTCTGTTTCCTTTGCCCAGGAACTGACAGGCACCATGCCCTACCAATACCCAGCGCTGACCCCGGAGCAGAAGAAAGAGCTGTCTGACATTGCTCACCGCATTGTGGCTCCGGGCAAAGGCATCTTGGCTGCAGATGAGTCCACTGGGAGCATTGCCAAGCGGCTGCAGTCCATTGGCACTGAGAACACCGAGGAGAACCGTCGCTTCTACCGCCAGCTGCTGCTGACTGCCGATGACCGTGTGAATCCCTGCATTGGGGGTGTCATCCTCTTCCATGAGACGCTTTATCAGAAGGCAGATGATGGGCGTCCCTTCCCCCAAGTTATCAAATCCAAGGGCGGTGTTGTGGGCATCAAGGTAGACAAGGGTGTGGTACCCCTGGCAGGAACAAATGGCGAGACTACCACCCAAGGATTGGATGGGCTGTCTGAGCGCTGTGCTCAGTACAAGAAGGATGGAGCTGACTTTGCCAAGTGGCGCTGTGTGCTGAAGATTGGGGAACACACTCCCTCAGCCCTTGCCATCATGGAAAATGCCAATGTTTTGGCCCGTTATGCCAGCATCTGCCAGCAGAATGGCATTGTGCCCATCGTGGAGCCTGAGATCCTCCCTGATGGGGACCACGACCTGAAGCGCTGTCAGTATGTAACTGAAAAGGTGCTGGCTGCTGTCTACAAGGCTCTGAGTGACCATCACATCTACCTGGAAGGCACCTTGCTGAAGCCTAATATGGTCACCCCAGGCCATGCCTGCACCCAGAAATTTTCTAACGAGGAGATTGCCATGGCAACTGTCACAGCGCTGCGCCGCACAGTGCCCCCTGCTGTCACTGGGATCACCTTCTTATCTGGAGGTCAGAGTGAGGAGGAGGCATCCATCAACCTCAATGCAATCAACAAGTGCCCCCTGCTGAAGCCTTGGGCCCTGACCTTTTCCTATGGCCGAGCCCTGCAGGCCTCTGCCCTGAAGGCCTGGGGTGGAAAGAAGGAGAACCTGAAGGCTGCCCAGGAGGAATATGTCAAGCGAGCACTGGCCAACAGCCTTGCCTGCCAAGGAAAGTACACCCCAAGTGGTCAGGCCGGGGCTGCAGCCAGCCAGTCCCTCTTCATATCTAACCATGCCTACTAAGCGGAGGTGTTCCAAGGCCGCCTCAACACTCCAGGTCCTGCCCGCTTCCACACACCTGAAGAGGGGGCCTCATCCGGGGCTCCAGGCTCCTCTTTCCCATCACTCTTACCTCCCTTGTGACATTGGTGCGTGGTGTTGTCTGTGAATGCTAACTCCATCGCCCTTTCCAGCCCACTGCCAATAAACAACTATTTAAGGGGGA