Transcript asmbl_35529

Sequence
Transcript Sequence for observation asmbl_35529 of TGE0009200:
GGGGCATAAGGCCTCTAGTTAGGTGTTTGATGGGCCTTTTGTGAAAGAAGGGCTTCAACTTGACTGGAAATGGGCCACCACAGTGGGTAGGGAACAGTTTAGGACCAAGCAGAAGTTTCTCCCCCCAGGTGGGTGGCGACGTCCCTGAGACCAACTACCTCTTCATGGGGGACTTTGTGGATCGTGGTTTCTACAGCGTTGAAACGTTCCTCCTGCTGCTGGCACTTAAGGTTCGCTATCCTGACCGAATCACCCTGATACGGGGCAACCATGAGAGCCGTCAGATCACCCAGGTCTACGGCTTCTATGATGAGTGCCTGCGCAAATATGGCTCAGTGACCGTGTGGCGCTACTGCACTGAGATCTTTGACTACCTCAGCCTGTCAGCTATCATTGATGGCAAGATCTTCTGCGTGCACGGGGGCCTCTCCCCTTCCATCCAGACCCTGGACCAGATCCGGACAATTGACCGAAAGCAAGAGGTGCCTCACGACGGGCCCATGTGTGACCTGCTCTGGTCTGACCCTGAAGACACAACAGGCTGGGGCGTGAGCCCCCGTGGAGCTGGCTACCTATTTGGCAGTGATGTGGTGGCCCAGTTCAATGCAGCCAACGACATTGACATGATCTGTCGTGCCCACCAACTGGTGATGGAAGGTTACAAGTGGCACTTCAATGAGACTGTGCTCACTGTGTGGTCAGCACCCAACTACTGCTACCGCTGTGGGAACGTGGCAGCCATCTTGGAGCTAGATGAGCATCTCCAGAAAGATTTTATCATCTTCGAGGCCGCTCCTCAAGAGACACGGGGCATCCCCTCCAAGAAGCCCGTGGCTGACTACTTCCTGTGACCCCTTTGGCCCCTGTCCCCCTCCAGCCCCTCTGGCCCTTGGACCACTGTGACTGCCCTCTTCAGACAGAGGCTGGGCATTGGGGGGCTGTCCCCGGCTCTGCTCTCCCCACAAAGAGGGCACTTTGAGGGTGAGGACTTTCTCTGGAGAGGCTCAGAGCCTCAGCTCCATGCTCCTCCTCTCCCTTCTCCCCACTTGAACCATGAAGTTTCCAAGAATTTTTTTGGTTTTTTTTTTCCTTTTTTTGTTTGTTTTTAGATAAAAATTTTGAGAAAAAGAAAAAAATTCTAATAAAAGAAGAAAAATGGTA