Transcript asmbl_27243

Sequence
Transcript Sequence for observation asmbl_27243 of TGE0000981:
CCCTCGCCCCACCCCCCAGGCATTCGCCGCCGCGACTCGCCCTTTCCCCGGCTGGGACCGCAGCCCCTCCCAGAAGCTCCCCCATCAGCAGCCGCCGGGACCCAACTATCGTCTTCCTCTTCGCCCGCTCTCCAGCCTTTCCTCTGCTAAGTCTCCATCGGGCATCGACCTCGCCCTGCCCCACCGGACACCGTAGCAGCAGCCCCAGCAGCGACGGGACAAAATGGGAGAGTGAGGCTGTCCTGCGTGGACCAGCTCGTGGCCGAGACTGATCGGTGCGTCGGGCCGGGCCGAGTAGAGCCGGGGACGCGGGGCTAGACCGTCTACAGCGCCTCTGAGCGGAGCGGGCCCGGCCCGTGGCCCGAGCGGCGGCCGCAGCTGGCACAGCTCCTCACCCGCCCTTTGCTTTCGCCTTTCCTCTTCTCCCTCCCTTGTTGCCCGGAGGGAGTCTCCACCCTGCTTCTCTTTCTCTACCCGCTCCTGCCCATCTCGGGACGGGGACCCCTCCATGGCGACGGCGGCCGGGGCCCGCTAGACTGAAGCACCTCGCCGGAGCGACGAGGCTGGTGGCGACGGCGCTGTCGGCTGTCGTGAGGGGCTGCCGGGTGGGATGCGACTTTGGGCGTCCGAGCGGCTGTGGGTCGCTGTTGCCCCCGGCCCGGGGTCTGGAGAGCGGAGGTCCCCTCAGTGAGGGGAAGACGGGGGAACCGGGCGCACCTGGTGACCCTGAGGTTCCGGCTCCTCCGCCCCGCGGCTGCGAACCCACCGCGGAGGAAGTTGGTTGAAATTGCTTTCCGCTGCTGGTGCTGGTAAGAGGGCATTGTCACAGCAGCAGCAACATGTCGACTGGGGACAGTTTTGAGACTCGATTTGAAAAAATGGACAACCTGCTGCGGGATCCCAAATCGGAAGTGAATTCGGATTGTTTGCTGGATGGATTGGATGCTTTGGTATATGATTTGGATTTTCCTGCCTTAAGAAAAAACAAAAATATTGACAACTTTTTAAGCAGATATAAAGACACAATAAATAAAATCAGAGATTTACGAATGAAAGCTGAAGATTATGAAGTAGTGAAGGTGATTGGTAGAGGTGCATTTGGAGAAGTTCAATTGGTAAGGCATAAATCCACCAGGAAGGTATATGCTATGAAGCTTCTCAGCAAATTTGAAATGATAAAGAGATCTGATTCTGCTTTTTTCTGGGAAGAAAGGGACATCATGGCTTTTGCCAACAGTCCTTGGGTTGTTCAGCTTTTTTATGCATTCCAAGATGATCGTTATCTCTACATGGTGATGGAATACATGCCTGGTGGAGATCTTGTAAACTTAATGAGCAACTATGATGTGCCTGAAAAATGGGCACGATTCTATACTGCAGAAGTAGTTCTTGCATTGGATGCAATCCATTCCATGGGTTTTATTCACAGAGATGTGAAGCCTGATAACATGCTGCTGGATAAATCTGGACATTTGAAGTTAGCAGATTTTGGTACTTGTATGAAGATGAATAAGGAAGGCATGGTACGATGTGATACAGCGGTTGGAACACCTGATTATATTTCCCCTGAAGTATTAAAATCCCAAGGTGGTGATGGTTATTATGGAAGAGAATGTGACTGGTGGTCGGTTGGGGTATTTTTATACGAAATGCTTGTAGGTGATACACCTTTTTATGCAGATTCTTTGGTTGGAACTTACAGTAAAATTATGAACCATAAAAATTCACTTACCTTTCCTGATGATAATGACATATCAAAAGAAGCAAAAAACCTTATTTGTGCCTTCCTTACTGACAGGGAAGTGAGGTTAGGGCGAAATGGTGTAGAAGAAATCAAACGACATCTCTTCTTCAAAAATGACCAGTGGGCTTGGGAAACGCTCCGAGACACTGTAGCACCAGTTGTACCCGATTTAAGTAGTGACATTGATACTAGTAATTTTGATGACTTGGAAGAAGATAAAGGAGAGGAAGAAACATTCCCTATTCCTAAAGCTTTCGTTGGCAATCAACTACCTTTTGTAGGATTTACATATTATAGCAATCGTAGATACTTATCTTCAGCAAATCCTAATGATAACAGAACTAGCTCCAATGCAGATAAAAGCTTGCAGGAAAGTTTGCAAAAAACAATCTATAAGCTGGAAGAACAGCTGCATAATGAAATGCAGTTAAAAGATGAAATGGAGCAGAAGTGCAGAACCTCAAACATAAAACTAGACAAGATAATGAAAGAATTGGATGAAGAGGGAAATCAAAGAAGAAATCTAGAATCTACAGTGTCTCAGATTGAGAAGGAGAAAATGTTGCTACAGCATAGAATTAATGAGTACCAAAGAAAAGCTGAACAGGAAAATGAGAAGAGAAGAAATGTAGAAAATGAAGTTTCTACATTAAAGGATCAGTTGGAAGACTTAAAGAAAGTCAGTCAGAATTCACAGCTTGCTAATGAGAAGCTGTCCCAGTTACAAAAGCAGCTAGAAGAAGCCAATGACTTACTTAGGACAGAATCGGACACAGCTGTAAGATTGAGGAAGAGTCACACAGAGATGAGCAAGTCAATTAGTCAGTTAGAGTCCCTGAACAGAGAGTTGCAAGAGAGAAATCGAATTTTAGAGAATTCTAAGTCACAAACAGACAAAGATTATTACCAGCTGCAAGCTATATTAGAAGCTGAACGAAGAGACAGAGGTCATGATTCTGAGATGATTGGAGACCTTCAAGCTCGAATTACATCTTTACAAGAGGAGGTGAAGCATCTCAAACATAATCTCGAAAAAGTGGAAGGAGAAAGAAAAGAGGCTCAAGACATGCTTAATCACTCAGAAAAGGAAAAGAATAATTTAGAGATAGATTTAAACTACAAACTTAAATCATTACAACAACGGTTAGAACAAGAGGTAAATGAACACAAAGTAACCAAAGCTCGTTTAACTGACAAACATCAATCTATTGAAGAGGCAAAGTCTGTGGCAATGTGTGAGATGGAAAAAAAGCTGAAAGAAGAAAGAGAAGCTCGAGAGAAGGCTGAAAATCGGGTTGTTCAGATTGAGAAACAGTGTTCCATGCTAGACGTTGATCTGAAGCAATCTCAGCAGAAACTAGAACATTTGACTGGAAATAAAGAAAGGATGGAGGATGAAGTTAAGAATCTAACCCTGCAACTGGAGCAGGAATCAAATAAGCGGCTGTTGTTACAAAATGAATTGAAGACTCAAGCATTTGAGGCAGACAATTTAAAAGGTTTAGAAAAGCAGATGAAACAGGAAATAAATACTTTATTGGAAGCAAAGAGATTATTAGAATTTGAGTTAGCTCAGCTTACGAAACAGTATAGAGGAAATGAAGGACAGATGCGGGAGCTACAAGATCAGCTTGAAGCTGAGCAATATTTCTCGACACTTTATAAAACCCAGGTAAAGGAACTTAAAGAAGAAATTGAAGAAAAAAACAGAGAAAATTTAAAGAAAATACAGGAACTACAAAATGAAAAAGAAACTCTTGCTACTCAGTTGGATCTAGCAGAAACAAAAGCTGAGTCTGAGCAGTTGGCGCGAGGCCTTCTGGAAGAACAGTATTTTGAATTGACGCAAGAAAGCAAGAAAGCTGCTTCAAGAAATAGACAAGAGATTACAGATAAAGATCACACTGTTAGTCGGCTTGAAGAAGCAAACAGCATGCTAACCAAAGATATTGAAATATTAAGAAGAGAGAATGAAGAGCTAACAGAGAAAATGAAGAAGGCAGAGGAAGAATATAAACTGGAGAAGGAGGAGGAGATCAGTAATCTTAAGGCTGCCTTTGAAAAGAATATCAACACTGAACGAACCCTTAAAACACAGGCTGTTAACAAATTGGCAGAAATAATGAATCGAAAAGATTTTAAAATTGATAGAAAGAAAGCTAATACACAAGATTTGAGAAAGAAAGAAAAGGAAAATCGAAAGCTGCAACTGGAACTCAACCAAGAAAGAGAGAAATTCAACCAGATGGTAGTGAAACATCAGAAGGAACTGAATGACATGCAAGCGCAATTGGTAGAAGAATGTGCACATAGGAATGAGCTTCAGATGCAGTTGGCCAGCAAAGAGAGTGATATTGAGCAATTGCGTGCTAAACTTTTGGACCTCTCGGATTCTACAAGTGTTGCTAGTTTTCCTAGTGCTGATGAAACTGATGGTAACCTCCCAGAGTCAAGAATTGAAGGTTGGCTTTCAGTACCAAATAGAGGAAATATCAAACGATATGGCTGGAAGAAACAGTATGTTGTGGTAAGCAGCAAAAAAATTTTGTTCTATAATGACGAACAAGATAAGGAGCAATCCAATCCATCTATGGTATTGGACATAGATAAACTGTTTCACGTTAGACCTGTAACCCAAGGAGATGTGTATAGAGCTGAAACTGAAGAAATTCCTAAAATATTCCAGATACTATATGCAAATGAAGGTGAATGTAGAAAAGATGTAGAGATGGAACCAGTACAACAAGCTGAAAAAACTAATTTCCAAAATCACAAAGGCCATGAGTTTATTCCTACACTCTACCACTTTCCTGCCAATTGTGATGCCTGTGCCAAACCTCTCTGGCATGTTTTTAAGCCACCCCCTGCCCTAGAGTGTCGAAGATGCCATGTTAAGTGCCACAGAGATCACTTAGATAAGAAAGAGGACTTAATTTGTCCATGTAAAGTAAGTTATGATGTAACATCAGCAAGAGATATGCTGCTGTTAGCATGTTCTCAGGATGAACAAAAAAAATGGGTAACTCATTTAGTAAAGAAAATCCCTAAGAATCCACCATCTGGTTTTGTTCGTGCTTCCCCTCGAACGCTTTCTACAAGATCCACTGCAAATCAGTCTTTCCGGAAAGTGGTCAAAAATACATCTGGAAAAACTAGTTAACCATGTGACTGAGTGCCCTGTGGAATCGTGTGGGATGCTACCTGATAAACCAGGCTTCTTTAACCATGCAGAGCAGACAGGCTGTTTCTTTGACACAAATATCACAGGCTTCAGGGTTAAGATTGCTGTTTTTCTGTCCTTGCTTTGGCACAACACACTGAGGGTTTTTTTTATTGCGGGTTTGCCTACAGGTAGATTAGATTAATTATTACTATGTAATGCAAGTACAGTTGGGGGAAAGCTTAGGTAGATATATTTTTTTTAAAAGGTGCTGCCTTTTTGGATTTATAAGAAAATGCCTGTCAGTCGTGATAGAACAGAGTTTTCCTCATATGAGTAAGAGGAAGGGACTTTCACTTTCAAGTGGAACAGCCATCACTATCAAGATCAGCTCATGGAAGGAGTAAAGAAAATATCTCAAAATGAGACAAACTGAAGTTTTGTTTTTTTTTTAATGACTTAAGTTTTTGTGCTCTTGCAAGACTATACAAAACTATTTTAAGAAAGCAGTGATATCACTTGAACTTCAGTGCCCTCACTGTAGAATTTAAAAGCCTTACTGTTGATTGCCCATGTTGGACTTGATGGAGAAATTAAATATCTTTCATTATGCTTTACAAAATACTGTATATGTTTCAGCAAGTTTGGGGAATGGGAGAGGACAAAAAAAAGTTACATTTAATCTATGCATTTTTGCCAAGCCATATTGAGTTATTTTACTACTAGAGACATTAGGAAACTAACTGTACAAAAGAACCAAGTTTAAAAGCATTTTGTGGGGT