Transcript asmbl_98113

Sequence
Transcript Sequence for observation asmbl_98113 of TGE0002280:
GGGTGCCCAGGGCAGCCAGGGGCGCACGGGTTGGGAGGCGCCAGGCGGCCCGCCCTCCTTGCACGGGCCGGCCCAGCTTCCCCGCCCCTGGCGTCCGCTCCCTCCCGCTCGCAGCTTACTTAACCTGGCCCGGGCGGCGGAGGCGCTCTCACTTCCCTGGAGCCGCCCGCTTGCCCGTCGGTCGCTAGCTCGCTCGGTGCGCGTCGTCCCGCTCCATGGCGCTCTTCGTGCGGCTGCTGGCTCTCGCCCTGGCTCTGGCCCTGGGCCCCGCCGCGACCCTGGCGGGTCCCGCCAAGTCGCCCTACCAGCTGGTGCTGCAGCACAGCAGGCTCCGGGGCCGCCAGCACGGCCCCAACGTGTGTGCTGTGCAGAAGGTTATTGGCACTAATAGGAAGTACTTCACCAACTGCAAGCAGTGGTACCAAAGGAAAATCTGTGGCAAATCAACAGTCATCAGCTACGAGTGCTGTCCTGGATATGAAAAGGTCCCTGGGGAGAAGGGCTGTCCAGCAGCCCTACCACTCTCAAACCTTTACGAGACCCTGGGAGTCGTTGGATCCACCACCACTCAGCTGTACACGGACCGCACGGAGAAGCTGAGGCCTGAGATGGAGGGGCCCGGCAGCTTCACCATCTTCGCCCCTAGCAACGAGGCCTGGGCCTCCTTGCCAGCTGAAGTGCTGGACTCCCTGGTCAGCAATGTCAACATTGAGCTGCTCAATGCCCTCCGCTACCATATGGTGGGCAGGCGAGTCCTGACTGATGAGCTGAAACACGGCATGACCCTCACCTCTATGTACCAGAATTCCAACATCCAGATCCACCACTATCCTAATGGGATTGTAACTGTGAACTGTGCCCGGCTGCTGAAAGCCGACCACCATGCAACCAACGGGGTGGTGCACCTCATCGATAAGGTCATCTCCACCATCACCAACAACATCCAGCAGATCATTGAGATCGAGGACACCTTTGAGACCCTTCGGGCTGCTGTGGCTGCATCAGGGCTCAACACGATGCTTGAAGGTAACGGCCAGTACACGCTTTTGGCCCCGACCAATGAGGCCTTCGAGAAGATCCCTAGTGAGACTTTGAACCGTATCCTGGGCGACCCAGAAGCCCTGAGAGACCTGCTGAACAACCACATCTTGAAGTCAGCTATGTGTGCTGAAGCCATCGTTGCGGGGCTGTCTGTAGAGACCCTGGAGGGCACGACACTGGAGGTGGGCTGCAGCGGGGACATGCTCACTATCAACGGGAAGGCGATCATCTCCAATAAAGACATCCTAGCCACCAACGGGGTGATCCACTACATTGATGAGCTACTCATCCCAGACTCAGCCAAGACACTATTTGAATTGGCTGCAGAGTCTGATGTGTCCACAGCCATTGACCTTTTCAGACAAGCCGGCCTCGGCAATCATCTCTCTGGAAGTGAGCGGTTGACCCTCCTGGCTCCCCTGAATTCTGTATTCAAAGATGGAACCCCTCCAATTGATGCCCATACAAGGAATTTGCTTCGGAACCACATAATTAAAGACCAGCTGGCCTCTAAGTATCTGTACCATGGACAGACCCTGGAAACTCTGGGCGGCAAAAAACTGAGAGTTTTTGTTTATCGTAATAGCCTCTGCATTGAGAACAGCTGCATCGCGGCCCACGACAAGAGGGGGAGGTACGGGACCCTGTTCACGATGGACCGGGTGCTGACCCCCCCAATGGGGACTGTCATGGATGTCCTGAAGGGAGACAATCGCTTTAGCATGCTGGTAGCTGCCATCCAGTCTGCAGGACTGACGGAGACCCTCAACCGGGAAGGAGTCTACACAGTCTTTGCTCCCACAAATGAAGCCTTCCGAGCCCTGCCACCAAGAGAACGGAGCAGACTCTTGGGAGATGCCAAGGAACTTGCCAACATCCTGAAATACCACATTGGTGATGAAATCCTGGTTAGCGGAGGCATCGGGGCCCTGGTGCGGCTAAAGTCTCTCCAAGGTGACAAGCTGGAAGTCAGCTTGAAAAACAATGTGGTGAGTGTCAACAAGGAGCCTGTTGCCGAGCCTGACATCATGGCCACAAATGGCGTGGTCCATGTCATCACCAATGTTCTGCAGCCTCCAGCCAACAGACCTCAGGAAAGAGGGGATGAACTTGCAGACTCTGCGCTTGAGATCTTCAAACAAGCATCAGCGTTTTCCAGGGCTTCCCAGAGGTCTGTGCGACTAGCCCCTGTCTATCAAAAGTTATTAGAGAGGATGAAGCATTAGCTTGAAGCACTACAGGAGGAATGCACCACGGCAGCTCTCCGCCAATTTCTCTCAGATTTCCACAGAGACTGTTTGAATGTTTTCAAAACCAAGTATCACACTTTAATGTACATGGGCCGCACCATAATGAGATGTGAGCCTTGTGCATGTGGGGGAGGAGGGAGAGAGATGTACTTTTTAAATCATGTTCCCCCTAAACATGGCTGTTAACCCACTGCATGCAGAAACTTGGATGTCACTGCCTGACATTCACTTCCAGAGAGGACCTATCCCAAATGTGGAATTGACTGCCTATGCCAAGTCCCTGGAAAAGGAGCTTCAGTATTGTGGGGCTCATAAAACATGAATCAAGCAATCCAGCCTCATGGGAAGTCCTGGCACAGTTTTTGTAAAGCCCTTGCACAGCTGGAGAAATGGCATCATTATAAGCTATGAGTTGAAATGTTCTGTCAAATGTGTCTCACATCTACACGTGGCTTGGAGGCTTTTATGGGGCCCTGTCCAGGTAGAAAAGAAATGGTATGTAGAGCTTAGATTTCCCTATTGTGACAGAGCCATGGTGTGTTTGTAATAATAAAACCAAAGAAACATACGTCCTGTGTGCATGGTACAGTGTGCTGACCTGAGGCCGTCATGCTCCTCCACACCTCAATTCTGCTCTGGAGAAGCTCAGAAAGGAGCCCCGAGGGATGGTTTTGGGGAGATTCCAGCAGCCAGCCCTCAGACAGCCAGACAGCTCATGGGGGTTTGAGCCTGTCTTTGCCAAACAGGTTTTTATTTCACCCTCCTCCGGTCCTGGGGTTTCAAGTTTTCAGTGTTGCCTTCACCCCGCACTTTATTCCTCTTATTACTTGGAAGTACCTTCCCTCCAGCATGGTGATCCCCTGCCTGTGTGCTGGACTTTTGAGTCCTCAGCACCAACCTGTGAAGTGGTTGCCAGCATAATCCCATTATGCAGATGAGGAGACCAAGGCCCAGGGAAGGGAGAACCACCAGCAGCACGTAAAATAGCTGAGCTGGGACTGGAACTCACACCTCCTGACTCTCAGTGACCACCACTGACAAC