Transcript asmbl_8939

Sequence
Transcript Sequence for observation asmbl_8939 of TGE0056385:
CAGGGCGTAGCAGGCGGAAGTAAGGGTGAGAGGAGGCTGCAACGCCGAGCGGAGGAGGCAGGAACCGGAGCGCGAGCAGTAGCTGGGTGGGCACCATGGCTGGGATCACCACCATCGAGGCGGTGAAGCGCAAGATCCAGGTTCTGCAGCAGCAGGCAGATGATGCAGAGGAGCGAGCTGAGCGCCTCCAGCGAGAAGTTGAGGGAGAAAGGCGGGCCCGGGAACAGGCTGAGGCTGAGGTGGCCTCCTTGAACCGTAGGATCCAGCTGGTTGAAGAAGAGCTGGACCGTGCTCAGGAGCGCCTGGCCACTGCCCTGCAAAAGCTGGAAGAAGCTGAAAAAGCTGCTGATGAGAGTGAGAGAGGTATGAAGGTTATTGAAAACCGGGCCTTAAAAGATGAAGAAAAGATGGAACTCCAGGAAATCCAACTCAAAGAAGCTAAGCACATTGCAGAAGAGGCAGATAGGAAGTATGAAGAGGTGGCTCGTAAGTTGGTGATCATTGAAGGAGACTTGGAACGCACAGAGGAACGAGCTGAGCTGGCAGAGTCCCGTTGCCGAGAGATGGATGAGCAGATTAGACTGATGGACCAGAACCTGAAGTGTCTGAGTGCTGCTGAAGAAAAGTACTCTCAAAAAGAAGATAAATATGAGGAAGAAATCAAGATTCTTACTGATAAACTCAAGGAGGCAGAGACCCGTGCTGAGTTTGCTGAGAGATCGGTAGCCAAGCTGGAAAAGACAATTGATGACCTGGAAGATAAACTGAAATGCACCAAAGAGGAGCACCTCTGTACACAAAGGATGCTGGACCAGACCCTGCTTGACCTGAATGAGATGTAGAACGCCCCAGTCCCACCCTGCTGCTGCTCCTCCCTCTGACCCAGACTCCGCCTGAGGCCAGCCTGCGGGAAGCTGACCTTTAACTGAGGGCTGATCTTTAACTGGAAGGCTGCTTTCTCCTTTCACCACCCCCTCCTTCCCTGTGTCTTTTTCGCCAAACTGTCTCTGCCTCTTCCCGGAGAATCCAGCTGGGCTAGAGGCTGAGCACCTTTGGAAACAACATTTAAGGGAATGTGAGCACAATGCATAATGTCTTTAAAAAGCATGTTGTGATGTACACATTTTGTAATTACCTTTTTTGTTGTTTTGTAGCAACCATTTGTAAAACATTCCAAATAATTCCACAGTCCTGAAGCAGCAATCGAATCCCTTTCTCACTTTTGGAAGGTGACTTTTCACCTTAATGCATATTCCCCTCTCCATAGAGGAGAGGAAAAGGTGTAGGCCTGCCTTACCGAGAGCCAAACAGAGCCCAGGGAGACTCCGCTGTGGGAAACCTCATTGTTCTGTACAAAGTACTAGCTAAACCAGAAAGGTGATTCCAGGAGGAGTTAGCCAAACAACAACAAAAACAAAAAATGTGCTGTTCAAGTTTTCAGCTTTAAGATATCTTTGGATAATGTTATTTCTATTTTTTATTTTTTTCATTAGAAGTTACCAAATTAAGATGGTAAGACCTCTGAGACCAAAATTTTGTCCCATCTCTACCCCCTCACAACTGCTTACAGAATGGATCATGTCCCCCTTATGTTGAGGTGACCACTTAATTGCTTTCCTGCCTCCTTGAAAGAAAGAAAGAAAGAAGACTGTGTTTTTGCCACTGATTTAGCCATGTGAAACTCATCTCATTACCCTTTTCTGGGTTTGAAGCTGCTGTCTCTAGAAGTGCCATCTCAATTGTGCTTTGTATCAGTCAGTGCTGGAGAAATCTTGAATAGCTTATGTACAAAACTTTTTAAATTTTATATTATTTTGAAACTTTGCTTTGGGTTTGTGGCACCCTGGCCACCCCATCTGGCTGTGACAGCCTCTGCAGTCCGTGGGCTGGCAGTTTGTTGATCTTTTAAGTTTCCTTCCCTACCCAGTCCCCATTTTCTGGTAAGGTTTCTAGGAGGTCTGTTAGGTGTACATCCTGCAGCTTATTGGCTTAAAATGTACTCTCCTTTTATGTGGTCTCTTTGGGGCCGATTGGGAGAAAGAGAAATCAATAGTGCAACTGTTTTGATACTGAATATTGACAAGTGTCTTTTTGAAATAAAGAACCAGTCCCTCCAACCCTCAGA