Transcript asmbl_80887

Sequence
Transcript Sequence for observation asmbl_80887 of TGE0061554:
GCGATTCCCAACTTTGCTCAAAGTCGCTGGACTCTAAGCTGTCGGAGGGACCGCTGGACAGACCTGGGAACTGACAGAGGGCCTGGAGGGAAACAGGCCAAAGACCCACAGGCAGAGTTGACACGGAACCCCAAAGCAAGGAGGAGGGCTCGGGCCCGAGACCGTTCACCTCCCCTTATCCCTGTTCCCCTCTTCAGGATGGAGCTGACCTCAAGGGAAAGAGGGAGGGGACAGCCTCTGCCCTGGGAACTTCGACTGGGCCTACTGCTAAGCGTGCTGGCTGCCACACTGGCACAGGCCCCTGCCCCGGATGTGCCTGGCTGTTCCAGGGGAAGCTGCTACCCCGCCACGGGCGACCTGCTGGTGGGCCGAGCTGACAGACTGACTGCCTCATCCACTTGTGGCCTGAATGGCCCCCAGCCCTACTGCATCGTCAGTCACCTGCAGGACGAAAAGAAGTGCTTCCTTTGTGACTCCCGGCGCCCCTTCTCTGCTAGAGACAACCCACACAGCCATCGCATCCAGAATGTAGTCACCAGCTTTGCACCACAGCGGCGGGCAGCCTGGTGGCAGTCAGAGAATGGTATCCCTGCGGTCACCATCCAGCTGGACCTGGAGGCTGAGTTTCATTTCACACACCTCATTATGACCTTCAAGACATTTCGCCCTGCTGCCATGCTGGTGGAACGCTCAGCAGACTTTGGCCGCACCTGGCATGTGTACCGATATTTCTCCTATGACTGTGGGGCTGACTTCCCAGGAGTCCCACTAGCACCCCCACGGCACTGGGATGATGTAGTCTGTGAGTCCCGCTACTCAGAGATTGAGCCATCCACTGAAGGCGAGGTCATCTATCGTGTGCTGGACCCTGCCATCCCTATCCCAGACCCCTACAGCTCACGGATTCAGAACCTGTTGAAGATCACCAACCTACGGGTGAACCTGACTCGTCTACACACGTTGGGAGACAACCTACTCGACCCACGGAGGGAGATCCGAGAGAAGTACTACTATGCCCTCTATGAGCTGGTTGTACGTGGCAACTGCTTCTGCTACGGACACGCCTCAGAGTGTGCACCCGCCCCAGGGGCACCAGCCCATGCTGAGGGCATGGTGCACGGAGCTTGCATCTGCAAACACAACACACGTGGCCTCAACTGCGAGCAGTGTCAGGATTTCTATCGTGACCTGCCCTGGCGTCCGGCTGAGGACGGCCATAGTCATGCCTGTAGGAAGTGTGAGTGCCATGGGCACACCCACAGCTGCCACTTCGACATGGCCGTATACCTGGCATCTGGCAATGTGAGTGGAGGTGTGTGTGATGGATGTCAGCATAACACAGCTGGGCGCCACTGTGAGCTCTGTCGGCCCTTCTTCTACCGTGACCCAACCAAGGACCTGCGGGATCCGGCTGTGTGCCGCTCCTGTGATTGTGACCCCATGGGTTCTCAAGACGGTGGTCGCTGTGATTCCCATGATGACCCTGCACTGGGACTGGTCTCCGGCCAGTGTCGCTGCAAAGAACATGTGGTGGGCACTCGCTGCCAGCAATGCCGTGATGGCTTCTTTGGGCTCAGCATCAGTGACCGTCTGGGCTGCCGGCGATGTCAATGTAATGCACGGGGCACAGTGCCTGGGAGCACTCCTTGTGACCCCAACAGTGGATCCTGTTACTGCAAACGTCTAGTGACTGGACGTGGATGTGACCGCTGCCTGGTGCGACTGGAAGGGGCTGGAGTTCTAGGGGCATGATTTGTCCTTAGAGCACAGGGCTGGGGTGTCACATCTATGCCAGTGGGTGGGTGCTGAGAGCTTAGGATCCAGTCCTGGCTGAGAAGCCTCAGGTCTGGGAGGCCAAGGATGTGGGCCAGTGGTCTGGGGGGCATGTTTTCACTGAGGGGTGATTGAGGCTAAGACGTGTGGTTGGGATTTCCTGCTGGGTGGTGATGGGGTCTGGAGGTCTGTTTCTGGCCCCCAGCAACTCCTTTCGTGCAGCCTGGCCACTGGGGCCTGAGCCACGACCTGCTCGGCTGCCGCCCCTGTGACTGCGACGTGGGTGGTGCTTTGGATCCCCAGTGTGATGAGGGCACAGGTCAATGCCACTGCCGCCAGCACATGGTTGGGCGACGCTGTGAGCAGGTGCAACCTGGCTACTTCCGGCCCTTCCTGGACCACCTAATTTGGGAGGCTGAGGACACCCGAGGGCAGGTGCTCGATGTGGTGGAGCGCCTGGTGACCCCCGGGGAAACTCCATCCTGGACTGGCTCAGGCTTCGTGCGGCTACAGGAAGGTCAGACCCTGGAGTTCCTGGTGGCCTCTGTGCCGAAGGCTATGGACTATGACCTGCTGCTGCGCTTAGAGCCCCAGGTCCCTGAGCAATGGGCAGAGTTGGAACTGATTGTGCAGCGTCCAGGGCCTGTGCCTGCCCACAGCCTGTGTGGGCATTTGGTGCCCAAGGATGATCGCATCCAAGGGACTCTGCAACCACATGCCAGGTACTTGATATTTCCTAATCCTGTCTGCCTTGAGCCTGGTATCTCCTACAAGCTGCATCTGAAGCTGGTACGGACAGGGGGAAGTGCCCAGCCTGAGACTCCCTACTCTGGACCTGGCCTGCTCATTGACTCGCTGGTGCTGCTGCCCCGTGTCCTGGTGCTAGAGATGTTTAGTGGGGGTGATGCTGCTGCCCTGGAGCGCCAGGCCACCTTTGAACGCTACCAATGCCATGAGGAGGGTCTGGTGCCCAGCAAGACTTCTCCCTCTGAGGCCTGCGCACCCCTCCTCATCAGCCTGTCCACCCTCATCTACAATGGTGCCCTGCCATGTCAGTGCAACCCTCAAGGTTCACTGAGTTCTGAGTGCAACCCTCATGGTGGTCAGTGCCTGTGCAAGCCTGGAGTGGTTGGGCGCCGCTGTGACCTCTGTGCCCCTGGCTACTATGGCTTTGGCCCCACAGGCTGTCAAGCCTGCCAGTGCAGCCACGAGGGGGCACTCAGCAGTCTCTGTGAAAAGACCAGTGGGCAATGTCTCTGTCGAACTGGTGCCTTTGGGCTTCGCTGTGACCGCTGCCAGCGTGGCCAGTGGGGATTCCCTAGCTGCCGGCCATGTGTCTGCAATGGGCATGCAGATGAGTGCAACACCCACACAGGCGCTTGCCTGGGCTGCCGTGATCACACAGGGGGTGAGCACTGTGAAAGGTGCATTGCTGGTTTCCACGGGGACCCACGGCTGCCATATGGGGGCCAGTGCCGGCCCTGTCCCTGTCCTGAAGGCCCTGGGAGCCAACGGCACTTTGCTACTTCTTGCCACCAGGATGAATATTCCCAGCAGATTGTGTGCCACTGCCGGGCAGGCTATACGGGGCTGCGATGTGAAGCTTGTGCCCCTGGGCACTTTGGGGACCCATCAAGGCCAGGTGGCCGGTGCCAACTGTGTGAGTGCAGTGGGAACATTGACCCAATGGATCCTGATGCCTGTGACCCCCACACGGGGCAATGCCTGCGCTGTTTACACCACACAGAGGGTCCACACTGTGCCCACTGCAAGCCTGGCTTCCATGGGCAGGCTGCCCGACAGAGCTGTCACCGCTGCACATGCAACCTGCTGGGCACAAATCCGCAGCAGTGCCCATCTCCTGACCAGTGCCACTGTGATCCAAGCAGTGGGCAGTGCCCATGCCTCCCCAATGTCCAGGGCCCTAGCTGTGACCGCTGTGCCCCCAACTTCTGGAACCTCACCAGTGGCCATGGTTGCCAGCCTTGTGCCTGCCACCCAAGCCGGGCCAGAGGCCCCACCTGCAACGAGTTCACAGGGCAGTGCCACTGCCGTGCCGGCTTTGGAGGGCGGACTTGTTCTGAGTGCCAAGAGCTCCACTGGGGAGACCCTGGGTTGCAGTGCCATGCCTGTGATTGTGACTCTCGTGGAATAGATACACCTCAGTGTCACCGCTTCACAGGTCACTGCAGCTGCCGCCCAGGGGTGTCTGGTGTGCGCTGTGACCAGTGTGCCCGTGGCTTCTCAGGAATCTTTCCTGCCTGCCATCCCTGCCATGCATGCTTCGGGGATTGGGACCGAGTGGTGCAGGACTTGGCAGCCCGTACACAGCGCCTAGAGCAGCGGGCGCAGGAGTTGCAACAGACGGGTGTGCTGGGTGCCTTTGAGAGCAGCTTCTGGCACATGCAGGAGAAGCTGGGCATTGTGCAGGGCATCGTAGGTGCCCGCAACACCTCAGCCGCCTCCACTGCACAGCTTGTGGAGGCCACAGAGGAGCTGCGGCGTGAAATTGGGGAGGCCACTGAGCACCTGACTCAGCTCGAGGCAGACCTGACAGATGTGCAAGATGAGAACTTCAATGCCAACCATGCACTAAGTGGTCTGGAGCGAGATAGGCTTGCACTTAATCTCACACTGCGGCAGCTCGACCAGCATCTTGACTTGCTCAAACATTCAAACTTCCTGGGTGCCTATGACAGCATCCGGCATGCCCATAGCCAGTCTGCAGAGGCAGAACGTCGTGCCAATACCTCAGCCCTGGCAGTACCTAGCCCTGTGAGCAACTCGGCAAGTGCTCGGCATCGGACAGAGGCACTGATGGATGCTCAGAAGGAGGACTTCAACAGCAAACACATGGCCAACCAGCGGGCACTTGGCAAGCTCTCTGCCCATACCCACACCCTGAGCCTGACAGACATAAATGAGCTGGTGTGTGGGGCACCAGGGGATGCACCCTGTGCTACAAGCCCTTGTGGGGGTGCCGGCTGTCGAGATGAGGATGGGCAGCCGCGCTGTGGGGGCCTCAGCTGCAATGGGGCAGCGGCTACAGCAGACCTAGCACTGGGCCGGGCCCGGCACACACAGGCAGAGCTGCAGCGGGCACTGGCAGAAGGTGGTAGCATCCTCAGCAGAGTGGCTGAGACTCGTCGGCAGGCAAGCGAGGCACAGCAGCGGGCCCAGGCAGCCCTGGACAAGGCTAATGCTTCCAGGGGACAGGTGGAACAGGCCAACCAGGAACTTCAAGAACTTATCCAGAGTGTGAAGGACTTCCTCAACC