Transcript asmbl_75827

Sequence
Transcript Sequence for observation asmbl_75827 of TGE0056330:
CCTTGCCCTCCGCTCTCACTCTGGCTGGGAGCAGAAGGCAGCCTCGGTCTCTGGGCGGCGGCGGCGGCCCACTCTGCCCTGGCCGCGCTGTGTGGTGACCGCAGGCCCCAGACATGAGGGCGGCCCGTGCTCTGCTGCCCCTGCTGCTGCAGGCCTGCTGGACAGCCGCGCAGGATGAGCCGGAGACCCCGAGGGCCGTGGCCTTCCAGGACTGCCCCGTGGACCTGTTCTTTGTGCTGGACACCTCTGAGAGCGTGGCCCTGAGGCTGAAGCCCTACGGGGCCCTCGTGGACAAAGTCAAGTCCTTCACCAAGCGCTTCATCGACAACCTGAGGGACAGGTACTACCGCTGTGACCGAAACCTGGTGTGGAACGCAGGCGCGCTGCACTACAGTGACGAGGTGGAGATCATCCAAGGCCTCACGCGCATGCCTGGCGGCCGCGACGCACTCAAAAGCAGCGTGGACGCGGTCAAGTACTTTGGGAAGGGCACCTACACCGACTGCGCTATCAAGAAGGGGCTGGAGCAGCTCCTCGTGGGGGGCTCCCACCTGAAGGAGAATAAGTACCTGATTGTGGTGACCGACGGGCACCCCCTGGAGGGCTACAAGGAACCCTGTGGGGGGCTGGAGGATGCTGTGAACGAGGCCAAGCACCTGGGCGTCAAAGTCTTCTCGGTGGCCATCACACCCGACCACCTGGAGCCGCGTCTGAGCATCATCGCCACGGACCACACGTACCGGCGCAACTTCACGGCGGCTGACTGGGGCCAGAGCCGCGACGCAGAGGAGGCCATCAGCCAGACCATCGACACCATCGTGGACATGATCAAAAATAACGTGGAGCAAGTGTGCTGCTCCTTCGAATGCCAGCCTGCAAGAGGACCTCCGGGGCTCCGGGGCGACCCCGGCTTTGAGGGAGAACGAGGCAAGCCGGGGCTCCCAGGAGAGAAGGGAGAAGCCGGAGATCCTGGAAGACCCGGGGACCTCGGACCTGTTGGGTACCAGGGAATGAAGGGAGAAAAAGGGAGCCGTGGGGAGAAGGGCTCCAGGGGACCCAAGGGCTACAAGGGAGAGAAGGGCAAGCGTGGCATCGACGGGGTGGACGGCGTGAAGGGGGAGATGGGGTACCCAGGCCTGCCAGGCTGCAAGGGCTCGCCCGGGTTTGACGGCATTCAAGGACCCCCTGGCCCCAAGGGAGACCCCGGTGCCTTTGGACTGAAAGGAGAAAAGGGCGAGCCTGGAGCTGACGGGGAGGCGGGGAGACCAGGGAGCTCGGGACCATCTGGAGACGAGGGCCAGCCGGGAGAGCCTGGGCCCCCCGGAGAGAAAGGAGAGGCGGGCGACGAGGGGAACCCAGGACCTGACGGTGCCCCCGGGGAGCGGGGTGGCCCTGGAGAGAGAGGACCACGGGGGACCCCAGGCACGCGGGGACCAAGAGGAGACCCTGGTGAAGCTGGCCCGCAGGGTGATCAGGGAAGAGAAGGCCCCGTTGGTGTCCCTGGAGACCCGGGCGAGGCTGGCCCTATCGGACCTAAAGGCTACCGAGGCGATGAGGGTCCCCCAGGGTCCGAGGGTGCCAGAGGAGCCCCAGGACCTGCCGGACCCCCTGGAGACCCGGGGCTGATGGGTGAAAGGGGAGAAGACGGCCCCGCTGGAAATGGCACCGAGGGCTTCCCCGGCTTCCCCGGGTATCCGGGCAACAGGGGCGCTCCCGGGATAAACGGCACGAAGGGCTACCCCGGCCTCAAGGGGGACGAGGGAGAAGCCGGGGACCCCGGAGACGATAACAACGACATTGCACCCCGAGGAGTCAAAGGAGCAAAGGGGTACCGGGGTCCCGAGGGCCCCCAGGGACCCCCAGGACACCAAGGACCGCCTGGGCCGGACGAATGCGAGATTTTGGACATCATCATGAAAATGTGCTCTTGCTGTGGTGAGACCCAGGCTCTAGCTCCTGAGAGAATGGATCCCGGGGGTCGGGGAGCGAGGCCTGGGTCCCACACATGTCACAGGACAGCACATGGCACTCTGGTCCCCGCCCGCAGCTCCCTGCACCTGCCCGCCCCCTCTGGGGCCTGCTCCAAGCCAGCAGGGTTCCCGGGTGTTGGGCTGGGCCCCGCCCTCTTTCACCCATAACTGAAATAACCAGGAGCAGGCTTGGGGGGGTCCCTGCTCCATCATTCTGGCCCACAGGCCCCACCCTAGCCTGGCTGAGCAACGCCAGCCCTGACCAGCCGCCGGACAGAGCAGCCTTTACGGGGCCATGGGAGGGGGTGGGCTTTTCTGGGGCTGAGACGGGGGGACCCCAACGTGTCAGGTGAGGATGTGGCAGCCAAGGAGGGG