Transcript asmbl_52668

Sequence
Transcript Sequence for observation asmbl_52668 of TGE0061081:
GGCCGCTGTCCCGGTGCGCACGGACGTGGCTCGAGTTTCCTCTGCTCTCCGCTCTCGCCCGCTAGCTCTCCTCCCTTCCGCTCCTGCTTCTCTCCGGGTCTCCCGCTCCAGCTCCAGCCCCACCCGGCCGGTCCCGCACGGCTCCGGGTAGCCATGGAGGACCCCACGCTCTATATTGTCGAGCGGCCGCTTCCCGGGTACCCCGACGCCGAGGCCCCGGAGCCTTCCTCCGCTGGGGCTCAGGCAGCGGAGGAGCCGTCGGGGGCCGGCTCAGAAGAGCTGATCAAGTCGGACCAGGTGAACGGCGTGCTGGTGCTGAGCCTCCTGGACAAAATCATCGGGGCCGTAGACCAGATCCAGCTGACTCAAGCACAGCTGGAGGAGCGGCAGGCGGAGATGGAGGGCGCAGTGCAGAGCATCCAGGGCGAGCTGAGCAAGCTGGGCAAGGCGCACGCCACCACGAGCAATACGGTGAGCAAGCTGCTGGAGAAGGTGCGCAAGGTCAGCGTCAACGTGAAGACCGTGCGCGGCAGCCTGGAGCGCCAGGCGGGGCAGATCAAGAAGCTGGAGGTCAACGAGGCCGAGCTGCTGCGGCGCCGCAACTTTAAAGTCATGATCTACCAGGATGAAGTGAAGCTGCCGGCCAAACTGAGCATCAGCAAATCGCTGAAAGAGTCGGAGGCGCTGCCAGAGAAGGAGGGCGAGGAGCTGGGCGAGGGCGAGCGGCCCGAGGAGGACGCAGCGGCGCTGGAGCTTTCGTCGGACGAGGCGGTGGAGGTTGAGGAGGTTATTGAGGAGTCCCGCGCAGAGCGTATCAAGCGCAGCGGCCTGCGGCGCGTGGACGACTTCAAGAAGGCCTTCTCCAAGGAGAAGATGGAGAAGACCAAGGTGCGTACCCGCGAGAACCTGGAGAAGACGCGCCTCAAGACCAAGGAAAACCTGGAGAAGACGCGGCACACCCTGGAGAAGCGCATGAACAAGCTGGGCACGCGCCTGGTGCCCGCCGAGCGGCGCGAGAAACTGAAGACGTCGCGGGACAAGTTGCGCAAATCCTTCACGCCCGACCACGTGGTGTACGCGCGCTCCAAGACCGCGGTCTACAAGGTGCCACCCTTCACCTTCCACGTCAAGAAGATCCGCGAGGGCCAGGTGGAAGTGCTCAAGGCCACCGAGATGGTGGAGGTGGGCGCCGACGACGACGAGGGCGGCGCGGAGCGCGGGGAGGCCGGCGACCTGCGGCGCGGGAGCAGCCCCGACGTGCACGCGCTGCTGGAGATCACCGAGGAGTCGGACGCCGTGCTGGTGGACAAGAGCGACAGCGACTGAGCCGCCCCCGCTGCCACCCACCCCATTCCTCGCTCCTTCCGAACTTCCTCTTTCGCATTCTCTCTCGGCTCGAGCTGGCTGAGATTTTTCTAAATTGAAAACACGCCCCCCTCCCCACACCTCCAGGAACTCCACTCCCAGTCTTAGAGCTGTTAGGACCCGATGGGGAGGCAGCCCCCGCAGTGGACAACCCCCGCTTGGACACAGTCCGAGTGGAATGGGAAGGGAATGGTCAATCCCTGTCCTGGTTGTCCAAGTCGGGATCTCAGAGGAAATTGCAGTGATTCCACGGTTAGGCCCCCCTGGGGGGGCTGCCTTCCCCTCAGCCTCTCCCCACACCACCCACCCAGCTGCTGTCATTCCGCTCACTGAGCTCTTCTTCATTCTCACCCTGATCCCTGGGGGACTCAAAGCCAAAACTGCCCAAAGAGGAAAGATTGAATCCTAAAGGGGATCCCTGCCCCCATGGGAGGCCCCCTACTAGAAGGACGTGAAAGCAGCTTTTGGGGGAAACTGAGGCAGTGGGGAAGACAGAGCAGAATGAGCCCTCACCCTGGCTGGGGGTCCAGCACAGGCTGTATCTGCAGAGGGTCCCAGAGGAACGCTGGAGCCAAGAGAAGCCCTGGGAAGGAGGGGTGGGGAACGACATGCATGTGAGGGATGGCACACTGATGTGTTTATGCACCTGTACACAGGAGCGCATGGCCATGGCTTTGGAAAGGAGAATGGAAAAATAGAAGAAGGTCGGCCGGGCTTGGTGGCTTATGCCTGTAACCCCAGCACTTTGGGA