Transcript asmbl_36592

Sequence
Transcript Sequence for observation asmbl_36592 of TGE0056530:
GTTCGAGGCTGGCGCGGCGCGGAGAGTGGGCTGGAGGCCGGGGCGGGACGCGTTGTGCAGCGGGTAAGCGCACGGCCGAGCGAGCATGGAGGGGGACCGGGTGGCCGGGCGGCCGGTGCTGTCGTCGTTACCAGTGCTACTGCTGCTGCCGTTGCTAATGTTGCGGGCCGCGGCGCTGCACCCAGACGAGCTCTTCCCACACGGGGAGTCGTGGGGGGACCAGCTCCTGCAGGAAGGCGACGACGAAAGCTCAGCCGTGGTGAAGCTGGCGAATCCCCTGCACTTCTACGAAGCCCGATTCAGCAACCTCTACGTGGGCACCAACGGCATCATCTCCACTCAGGACTTCCCCAGGGAAACGCAGTATGTGGACTATGATTTCCCCACCGACTTCCCGGCCATCGCCCCTTTTCTGGCGGACATCGACACGAGCCACGGCAGAGGCCGAGTCCTGTACCGAGAGGACACCTCCCCCGCAGTGCTGGGCCTGGCCGCCCGCTATGTGCGCGCTGGCTTCCCGCGCTCTGCGCGCTTTACCCCCACCCACGCCTTCCTGGCCACCTGGGAGCAGGTAGGCGCTTACGAGGAGGTCAAGCGCGGGGCGCTGCCCTCGGGAGAGCTGAACACTTTCCAGGCAGTTTTGGCATCTGATGGGTCTGATAGCTACGCCCTCTTTCTTTATCCTGCCAACGGCCTGCAGTTCCTTGGAACCCGCCCCAAAGAGTCTTACAATGTCCAGCTTCAGCTTCCAGCTCGGGTGGGCTTCTGCCGAGGGGAGGCTGATGATCTGAAGTCAGAAGGACCATATTTCAGCTTGACTAGCACTGAACAGTCTGTGAAAAATCTCTATCAACTAAGCAACCTGGGGATCCCTGGAGTGTGGGCTTTCCATATCGGCAGCACTTCCCCGTTGGACAATGTCAGGCCAGCTGCAGTTGGAGACCTTTCCGCTGCCCACTCTTCTGTTCCCCTGGGACGTTCCTTCAGCCATGCTACAGCCCTGGAAAGTGACTATAATGAGGACAATTTGGATTACTATGATGTGAATGAGGAGGAAGCTGAATACCTTCCGGGTGAACCAGAGGAGGCATTGAATGGCCACAGCAGCATTGATGTTTCCTTCCAATCCAAAGTGGATACAAAGCCTTTAGAGGAATCTTCCACCTTGGATCCTCACACCAAAGAAGGAACATCTCTGGGAGAGGTAGGGGGCCCAGATTTAAAAGGCCAAGTTGAGCCCTGGGATGAGAGAGAGACCAGAAGCCCAGCTCCACCAGAGGTAGACAGAGATTCACTGGCTCCTTCCTGGGAAACCCCACCACCGTACCCCGAAAACGGAAGCATCCAGCCCTACCCAGATGGAGGGCCAGTGCCTTCGGAAATGGATGTTCCCCCAGCTCATCCTGAAGAAGAAATTGTTCTTCGAAGTTACCCTGCTTCAGGTCACACTACACCCTTAAGTCGAGGGACGTATGAGGTGGGACTGGAAGACAACATAGGTTCCAACACCGAGGTCTTCACGTATAATGCTGCCAACAAGGAAACCTGTGAACACAACCACAGACAATGCTCCCGGCATGCCTTCTGCACGGACTATGCCACTGGCTTCTGCTGCCACTGCCAATCCAAGTTTTATGGAAATGGGAAGCACTGTCTGCCTGAAGGGGCACCTCACCGAGTGAATGGGAAAGTGAGTGGCCACCTCCACGTGGGCCATACACCCGTGCACTTCACTGATGTGGACCTGCATGCGTATATCGTGGGCAATGATGGCAGAGCCTACACGGCCATCAGCCACATCCCACAGCCAGCAGCCCAGGCCCTCCTCCCCCTCACACCAATTGGAGGCCTGTTTGGCTGGCTCTTTGCTTTAGAAAAACCTGGCTCTGAGAACGGCTTCAGCCTCGCAGGTGCTGCCTTTACCCATGACATGGAAGTTACATTCTACCCGGGAGAGGAGACGGTTCGTATCACTCAAACTGCTGAGGGACTTGACCCAGAGAACTACCTGAGCATTAAGACCAACATTCAAGGCCAGGTGCCTTACGTCTCAGCAAATTTCACAGCCCACATCTCTCCCTACAAGGAGCTGTACCACTACTCCGACTCCACTGTGACCTCTACAAGTTCCAGAGACTACTCTCTGACTTTTGGTGCAATCAACCAAACATGGTCCTACCGCATCCACCAGAACATCACTTACCAGGTGTGCAGGCACGCCCCCAGACACCCGTCCTTCCCCACCACCCAGCAGCTGAACGTGGACCGGGTCTTTGCCTTGTATAATGACGAAGAAAGAGTGCTTAGATTTGCTGTGACCAATCAAATTGGCCCGGTCAAAGAGGATTCAGACCCCACTCCGGGGAATCCTTGCTATGATGGGAGCCACATGTGTGACACAACAGCACGGTGCCATCCAGGGACAGGTGTAGATTACACCTGTGAGTGCGCATCTGGGTACCAGGGAGATGGACGGAACTGTGTGGATGAAAATGAATGTGCAACTGGCTTTCATCGCTGTGGCCCCAACTCTGTATGTATCAACTTGCCTGGAAGCTACAGGTGTGAGTGCCGGAGTGGTTATGAGTTTGCAGATGACCGGCATACTTGCATCTATGTAGATGAATGCTCAGAAAACAGATGTCACCCTGCAGCTACCTGCTACAATACTCCTGGTTCCTTCTCCTGCCGTTGTCAACCCGGATATTATGGGGATGGATTTCAGTGCATACCTGACTCCACCTCAAGCCTGACACCCTGTGAACAACAGCAGCGCCATGCCCAGGCCCAGTATGCCTACCCTGGGGCCCGGTTCCACATCCCCCAATGCGACGAGCAGGGCAACTTCCTGCCCCTACAGTGTCATGGCAGCACTGGTTTCTGCTGGTGCGTGGACCCTGATGGTCATGAAGTTCCTGGTACCCAGACTCCACCTGGCTCCACCCCGCCTCACTGTGGACCATCACCAGAGCCCACCCAGAGGCCCCCGACCATCTGTGAGCGCTGGAGGGAAAACCTGCTGGAGCACTACGGTGGCACCCCCCGGGATGACCAGTACGTGCCCCAGTGCGATGACCTGGGCCACTTCATCCCCCTGCAGTGCCACGGAAAGAGCGACTTCTGCTGGTGTGTGGACAAAGATGGCAGAGAGGTGCAGGGCACCCGCTCCCAGCCAGGCACCACCCCTGCGTGTATACCCACCGTCGCTCCACCCATGGTCCGGCCCACGCCCCGGCCAGATGTGACCCCTCCATCTGTGGGCACCTTCCTGCTCTATACTCAGGGCCAGCAGATTGGCTACTTACCCCTCAATGGCACCAGGCTTCAGAAGGATGCAGCTAAGACCCTGCTGTCTCTGCATGGCTCCATAATCGTGGGAATTGATTACGACTGCCGGGAGAGGATGGTGTACTGGACAGATGTTGCTGGACGGACAATCAGCCGTGCTGGTCTGGAACTGGGAGCAGAGCCTGAGACGATCGTGAATTCAGGTCTGATAAGCCCTGAAGGACTTGCCATAGACCACATCCGCAGAACAATGTACTGGACGGACAGTGTCCTGGATAAGATAGAGAGCGCCCTGCTGGATGGCTCTGAGCGCAAGGTCCTCTTCTACACAGATCTGGTGAATCCCCGTGCCATCGCTGTGGATCCAATCCGAGGCAACTTGTACTGGACAGACTGGAATAGAGAAGCTCCTAAAATTGAAACGTCATCTTTAGATGGAGAAAACAGAAGAATTCTGATCAATACAGACATTGGATTGCCCAATGGCTTAACCTTTGACCCTTTCTCTAAACTGCTCTGCTGGGCAGATGCAGGAACCAAAAAACTGGAGTGTACACTACCTGATGGAACTGGACGGCGTGTCATTCAAAACAACCTCAAGTACCCCTTCAGCATCGTAAGCTATGCAGATCACTTCTACCACACAGACTGGAGGAGGGATGGTGTTGTATCAGTAAATAAACATAGTGGCCAGTTTACTGATGAGTATCTCCCAGAACAACGATCTCACCTCTACGGGATAACTGCAGTCTACCCCTACTGCCCAACAGGAAGAAAGTAAGTACAGTAATGTAAAGGAAGACTTGGAGTTTACAATCAGAACCTGGACCCTAAAGAACAGTGACTGCAAAGGCAAAGAAAGTAAAAAAGGAATTGGCCATTAGACGTTCCTGAGCATCCAAGATGAACATTTTGTAGTGCAAAAAGACTTTTGTGAAAAGCTGATACCTCAATCTTTACTACTGTATTTTTAAAAATGAAGGTTGTTATTGCAAGTTTAAAAAGGTAACAGAATTTTAACTGTTGCTTATTAAAGCAACTTCTTGTAAACATTTATCATTAATATTTAAAAGATCAAATTCATTCAACTAAGAATTAGAGTTTAAGACTCTAAACCTGATTTTTGCCATGGATTCCTTCTGGCCAAGAAATTAAAGCACATGTGATCAATATAACAATATAATCCTAAACCTTGACAGTTGGAGAAGCCAATGCAGAACTGATGGGAAAGGACCAATTATTTATAGTTTCCCAACAAAAGTTCTAAGATTTTTTACCTCTGCATCAGTGCATTTCTATTTATATCAAAAGGTGCTAAAATGATTCAATTTGCATTTTCTGATCCTGTAGTGCCTCTATAGAAGTACCCACAGAAAGTAAAGTATCACATTTATAAATACCAAAGATGTAACAATTTTAAAATTTTCTAGATTACTCCAATAAAGTGTTTTAAGTTTTCCTATGACTTAAGGATCTATATTGTCTCTAGGACAAAGCTGGGGGTTGGCATATATGCCTTAACCACAAAGGAGAAAGGTGATTTATGCAAACATACAGTACATAATAAAAATTCTACTTTCCTAAACTTTATTAAAGAAAAAAGCAATAAGCAATGGTGGTAAATCTCTAGAACATACCCAATTTTCTGGGCTTCCTCCCCCGAGAATGTGACATTTTGATTTCCAAACATGCCAGAAGTGTATGGTTCCCAACTGTACTAAGTAGGTGAGAAGCTGAAGTCCTCAAGTGTTCATCTTCCAACTTTTCCCAGTCTGTGGTCTGTCTTTGGATCAGCAATAATTGCCTGAACAGCTACTATGGCTTCGTTGATTTTTGTCTGTAG