Transcript asmbl_30194

Sequence
Transcript Sequence for observation asmbl_30194 of TGE0056195:
CTAGGGTTGGGCCGAGAGTCGGAGCCATTACTGCAGGAAAAGGTCCCGGAGAGCTGAGCAGTCAAGATGTGTGACTTCACCGAAGACCAGACCGCAGATCTGATCCCAAGCACTGGAGTTCAAGGAGGCCTTCCAGCTGTTTGACCGAACAGGTGATGGCAAGATCCTGTACAGCCAGTGTGGGGATGTGATGAGGGCCCTGGGCCAGAACCCTACCAACGCCGAGGTGCTCAAGGTCCTGGGGAACCCCAAGAGTGATGAGATGAATGTGAAGGTGCTGGACTTTGAGCACTTTCTGCCCATGCTGCAGACAGTGGCCAAGAACAAGGACCAGGGCACCTATGAGGATTATGTCGAAGGACTTCGGGTGTTTGACAAGGAAGGAAATGGCACCGTCATGGGTGCTGAAATCCGGCATGTTCTTGTCACACTGGGTGAGAAGATGACAGAGGAAGAAGTAGAGATGCTGGTGGCAGGGCATGAGGACAGCAATGGTTGTATCAACTATGAAGGTAAGAGGTGAACTGCGCTTTCTCAGAGAAAGCAGCCATATGGGGCAGGTCAAGTATAGTGTCTGGGGCTTTCCCTATCCCTGGACTTGGGCTCCAAAAAGAGCCAGGAGGCAAGGTGCAGGGCCCTGCCCAGCCCAGCCCAGGAGTGGGAGGTCAGGGCGGTATAACAGGAAAGGAAGGGGGTAGTATTGTAGAGGGTGGGAAGGAATGAGAAGTGAAATAATGGAATGTCTGTCCCCACTGCCTGACCCCTCACCCCATGTCTTTGTCTTGTCTTCACCATGAATGTCTCTTCCTTCCTGCAGCGTTTGTGAGGCATATCCTGTCGGGGTGACGGGCCCATGGGGCGGGTACGGCTCCTCCCAGCCTCTCCTCTAGTTGATCTCCCCAGTGTTTCTTTTTTCCCCAACCTGTGCTCTTTATCCCCTGCCCTTACCCTACTACCATCTGACTTCCTCCTGGCATGTTTCTGCATGGAGCTGACTAGGGAGGGGAGGGATTCCTCAAAGAGGAAGACAACCTGGGGGTACAGTACCTCCTTACCTCTAGAATGGGCCCTGAGGTTTTACTTATGCGGCCCTGGGTGCTGGTGTCTGGGAACTCTCACCAGCCTGTATACCAGTCTTGCTTTAGGGTGACCTTCTGGCCCTGGAGCATGGGTAGCTGGCATAGAGGGGTATGGGTTGCCTGCCCCATTCTGCTGCTATAGCTGAACAGTCCTTTCCCCTTCCCTCGCTGGGCAGCTTGGAGGTACCCTAACCCAAAACTCTGTCCTCTCCTCCCGCCAGTGGCTGACAGTAGCTGTAGGTGTAGTGGAGAACTTTTCTGCCTCTGCTGTGTTCTTGCTGCTTAGGTTTGGGTGGGGGACTAACAGCTGCTGGGAGGGGAGCTAGGGGCATGGAGAACTGGTCAGACTCAAGGTGGCTCCTCTGCAAACTGACCCCAGGGTTGGTTGCTGTGGGCATGTTCCCGCTTATGCTACCTTTGCAGTCTGGTAGTCCCCTGGCCCTTGGCGTACCCCTCCACAGCCCTGTTCCCTGGCTCATCCCACCTTTCCTTTCCACAGAGCTCGTCCGCATGGTGCTGAATGGCTGAGGACCTTCCCAGTCTCCCCAGAGTCCGTGCCTTTCCCTGTGTGAATTTTGTATCTAGCCTAAAGTTTCCCTAGGCTTTCTTGTCTCAGCAACTTTCCCATCTTGTCTCTCTTGGATGATGTTTGCCGTCAGCATTCACCAAATAAACTTGCTCTCTGGGCCCTCGGTTCGGTTCTTTCTTTCCTGAACAGGGTAAAGGGGAAGAAGGTGAGATGGTGATGATTTCTGCCCTGAGGCAGAGTCCAAGGTCAATCAATGGTGCAGGGGTTGAGGAAAGCTGGGGGAGGCCCTGTACTAGCCATCTGGGCTTCATTTAAAAACTACTGGCCCCATTCATCCATCTTACACAAGCTACCTCTTGGGAGATTAGGAAAGCCATAGATCCCAGTAGGACTAAGGCTGGCCATCCCTGTTCCATTCCATATCAGGCTGTCTTCTCCTACCCTTCCAGCTCCTTAAATCTGGCCCCCGC