Transcript asmbl_116040

Sequence
Transcript Sequence for observation asmbl_116040 of TGE0056091:
CTTCCTGCCTTGGCCTCCCAAAATTCTAGGATTACAGGTGTGAGCTACCACACTTGGCCAGGGATGTCTAATGTGGCTGCTACACCCCATGTAAAAAGCGGAAAATAAAATGAAGATTTTCCAGCGCAAGATGCGGTACTGGTTGCTTCCACCTTTTTTGGCAATTGTTTATTTCTGCACCATTGTCCAAGGTCAAGTGGCTCCACCCACAAGGTTAAGATATAATGTAATATCTCATGACAGTATACAGATTTCATGGAAGGCTCCAAGAGGGAAATTTGGTGGTTACAAACTTCTTGTGACTCCAACTTCAGGTGGAAAAACTAACCAGCTGAATCTGCAGAACACTGCAACTAAAGCAATTATTCAAGGCCTTATGCCAGACCAGAATTACACAGTTCAAATTATTGCATACAATAAAGATAAAGAAAGCAAGCCAGCTCAAGGCCAATTCAGAATTAAAGATTTAGAAAAAAGAAAGGATCCAAAGCCCAGAGTCAAAGTTGTGGACAGAGGAAATGGGAGTAGACCATCTTCACCAGAAGAAGTGAAATTTGTCTGTCAAACTCCAGCAATTGCTGACATTGTAATCCTGGTCGATGGTTCATGGAGTATTGGAAGATTCAACTTCAGACTGGTTCGGCATTTCTTGGAAAACCTGGTTACAGCATTCGATGTGGGCTCAGAGAAGACACGAATTGGTCTTGCACAGTATAGTGGTGACCCCAGAATAGAATGGCACTTGAATGCATTTAGCACAAAAGATGAAGTGATTGAAGCTGTCCGAAACCTCCCATATAAAGGAGGAAATACACTAACAGGTCTTGCTTTGAACTACATTTTTGAAAATAGCTTCAAACCAGAAGCAGGATCAAGGACTGGAGTATCCAAAATTGGCATTTTAATCACAGATGGAAAATCCCAAGATGACATTATTCCACCATCTAGAAATCTTCGTGAGTCTGGTGTAGAACTGTTTGCCATAGGGGTGAAAAACGCGGATGTGAATGAGCTGCAGGAGATCGCCTCTGAACCAGACAGCACTCATGTGTACAATGTTGCCGAATTCGATCTGATGCACACAGTTGTGGAGAGTCTGACCAGGACTCTCTGCTCTAGAGTGGAAGAACAGGACAGAGAAATTAAAGCCTCAGCCCATGCCATCACTGGGCCGCCTACGGAGTTGATTACTTCTGAAGTCACTGCCAGAAGCTTTATGGTTAACTGGACTCATGCCCCAGGAAATGTGGAAAAATACAGAGTTGTGTATTATCCTACCAGGGGTGGAAAACCAGACGAGGTGGTGGTAGATGGAACTGTATCTTCCACAGTGTTGAAAAACTTGATGTCTTTAACTGAATATCAGATAGCAGTCTTTGCAATCTATGCCCACACTGCTAGTGAAGGCCTACGGGGAACTGAAACTACACTTGCTTTACCGATGGCTTCTGACCTTCTACTGTACGACGTGACTGAGAACAGCATGCGAGTCAAATGGGATGCAGTGCCTGGGGCCTCAGGTTACCTGATCCTTTATGCTCCTCTAACAGAGGGCCTGGCTGGGGATGAAAAAGAGATGAAAATTGGAGAGACCCACACAGATATTGAATTGAGTGGGTTGTTGCCCAATACAGAATACACAGTCACAGTTTATGCCATGTTTGGAGAAGAGGCCAGTGATCCTGTTACGGGACAAGAAACAACATTGGCTTTAAGTCCACCAAGAAACCTGAGAATCTCCAATGTTGGCTCTAACAGTGCTCGATTAACCTGGGACCCAACTTCAAGACAGATCAATGGTTATCGAATTGTATATAACAATGCAGATGGGACTGAAATCAATGAGGTTGAAGTCGATCCTATTACTACCTTCCCTCTGAAGGGCTTGACACCTCTCACAGAGTATACTATTGCTATTTTCTCCATCTATGATGAAGGACAGTCAGAGCCTCTGACTGGAGTTTTTACCACCGAGGAAGTTCCAGCCCAGCAATACTTAGAAATTGATGAGGTGACGACAGACAGTTTTAGGGTGACCTGGCATCCCCTCTCAGCTGATGAAGGGCTACACAAATTGATGTGGATTCCAGTCTATGGGGGGAAGACTGAGGAGGTTGTCCTGAAAGAAGAGCAGGACTCACATGTTATTGAAGGCCTGGAGCCCGGTACGGAGTATGAAGTTTCACTATTGGCCGTACTTGATGATGGAAGCGAGAGTGAGGTGGTGACTGCTGTCGGGACCACACTTGACAGTTTTTGGACAGAACCAGCTACAACCATAGTGCCTACCACATCTGTGACTTCAGTTTTCCAGACGGGAATCAGAAACCTAGTTGTAGGTGATGAAACTACTTCTAGCCTGCGGGTAAAATGGGACATTTCTGACAGCGATGTGCAGCAGTTTAGGGTGACCTACATGACAGCTCAAGGGGACCCTGAGGAAGAAGTCATAGGAACGGTTATGGTGCCTGGAAGCCAGAACAACCTCCTTCTGAAGCCTCTGCTTCCTGATACTGAATACAAAGTCACAGTGACTCCCATCTACACGGATGGCGAAGGCGTCAGCGTCTCCGCTCCTGGAAAAACCTTACCATCCTCGGGGCCCCAGAACTTGCGGGTGTCCGAGGAATGGTATAACCGGTTGCGCATTACGTGGGACCCCCCATCTTCCCCGGTGAAAGGCTATAGAATTGTCTACAAACCTGTCAGTGTTCCTGGTCCAACACTGGAAACGTTTGTGGGAGCTGACATTAACACCATCCTTATCACAAACCTCCTCAGCGGAATGGACTACAATGTGAAGATATTTGCCTCCCAGGCCTCAGGCTTCAGCGACGCCCTGACAGGCATGGTGAAAACATTGTTCTTGGGTGTTACCAATCTCCAAGCCAAACATGTTGAAATGACCAGCTTGTGTGCCCACTGGCAGGTACATCGCCATGCCACAGCCTATAGGGTTGTTATAGAATCCCTCCAGGATAGGCAAAAGCAAGAATCCACTGTGGGTGGAGGGACAACCAGGCATTGCTTCTATGGACTTCAGCCTGATTCTGAATATAAAATCAGTGTTTATACAAAGCTCCAGGAGATTGAAGGACCTAGTGTGAGCATAATGGAAAAAACACAATCACTTCCTACACGACCACCAACTTTTCCTCCAACCATTCCACCAGCAAAAGAAGTATGTAAGGCGGCCAAGGCTGACCTGGTATTTATGGTGGATGGATCCTGGAGCATTGGAGATGAAAATTTCAATAAGATCATCAGCTTTCTATACAGCACTGTTGGAGCCCTGAACAAGATTGGCACAGATGGAACCCAAGTTGCAATGGTTCAGTTCACTGATGATCCCAGAACAGAATTTAAACTAAATGCTTACAAAACCAAAGAGACTCTTCTTGATGCAATTAAACACATTTCATACAAAGGAGGAAATACAAAAACAGGAAAAGCAATTAAGTATGTTCGAGATACCTTGTTCACTGCAGAGTCAGGTACAAGAAGGGGCATCCCAAAGGTTATCGTGGTTATAACTGATGGAAGATCACAAGATGATGTGAACAAAATCTCCAGGGAGATGCAATTAGATGGCTATAGCATTTTTGCAATTGGTGTGGCCGATGCAGATTACTCGGAGTTGGTTAGCATTGGCAGTAAGCCCAGCGCACGCCATGTCTTCTTTGTGGATGACTTTGACGCCTTTAAGAAAATCGAAGATGAGTTAATTACTTTTGTCTGCGAAACAGCATCAGCAACCTGTCCAGTGGTACACAAGGATGGCATTGATCTTGCAGGATTTAAGATGATGGAAATGTTTGGTTTGGTTGAAAAAGATTTTTCATCAGTGGAAGGGGTTTCTATGGAGCCTGGTACCTTCAATGTGTTTCCATGTTACCAACTCCATAAAGATGCCCTGGTTTCCCAGCCAACCAGGTACTTGCACCCAGAAGGATTGCCCTCCGACTACACAATCAGTTTTCTATTCCGGATTCTTCCTGACACTCCACAGGAGCCATTTGCTCTTTGGGAGATTTTAAATAAAAATTCTGACCCATTGGTTGGGGTTATTTTAGACAATGGTGGGAAAACTCTAACATATTTCAACTATGACCAGAGTGGGGATTTTCAAACTGTTACTTTCGAAGGACCTGAAATTAGGAAAATTTTTTATGGAAGCTTTCACAAGCTACACATTGTTGTCAGTGAGACTTTGGTCAAAGTGGTTATTGACTGCAAGCAAGTGGGTGAGAAGGCAATGAACGCATCAGCTAATATCACGTCAGATGGTGTAGAAGTGCTAGGGAAAATGGTTCGATCAAGAGGACCAGGTGGAAACTCTGCACCGTTCCAGTTACAGATGTTTGATATTGTTTGCTCCACATCATGGGCCAATACAGACAAATGCTGTGAACTTCCAGGCCTGAGAGATGATGAGTCTTGCCCAGACCTTCCCCATTCCTGCTCCTGTTCTGAAACCAATGAAGTGGCTCTGGGACCAGCGGGCCCACCAGGTGGTCCAGGACTCCGAGGACCAAAGGGCCAGCAAGGTGAACCGGGTCCAAAGGGACCAGATGGCCCTCGGGGTGAAATTGGTCTGCCAGGACCTCAGGGTCCACCTGGACCTCAAGGACCAAGTGGTCTGTCCATTCAAGGAATGCCCGGAATGCCAGGAGAAAAAGGAGAGAAAGGAGATACTGGCCTTCCAGGTCCACAGGGTATCCCAGGAGGCGTTGGTTCACCAGGACGTGATGGCTCACCAGGCCAGAGGGGCCTTCCGGGAAAGGATGGATCCTCGGGACCTCCAGGACCACCAGGGCCAATAGGCATTCCTGGCACCCCTGGAGTCCCAGGGATCACAGGAAGCATGGGACCGCAAGGCGCCCTGGGACCACCTGGTGTCCCTGGAGCAAAGGGGGAACGAGGAGAGCGGGGTGACCTGCAGTCTCAAGCCATGGTGAGATCAGTGGCGCGTCAAGTATGCGAACAGCTCATCCAGAGTCACATGGCCAGGTACACTGCCATCCTCAACCAGATTCCCAGCCACTCCTCATCCATCCGGACTGTCCAAGGGCCTCCTGGGGAGCCTGGGAGGCCAGGCTCACCTGGAGCCCCTGGTGAACAAGGACCCCCAGGCACACCAGGCTTCCCCGGAAATGCAGGCGTGCCAGGGACCCCAGGAGAACGAGGTCTAACTGGTATCAAAGGAGAAAAAGGAAATCCAGGCGTTGGAACCCAAGGTCCAAGAGGCCCCCCTGGACCAGCAGGACCTTCAGGGGAGAGTCGGCCTGGCAGCCCTGGGCCCCCTGGCTCTCCTGGACCAAGAGGCCCACCAGGTCATCTGGGGGTTCCTGGACCCCAAGGTCCTTCTGGCCAGCCTGGATATTGTGACCCCTCATCATGTTCTGCCTATGGTGTGAGAGATCTGATCCCCTACAATGATTACCAGCACTGAAGTGGAAATCCTCCACTCTGGTTCCATTGGCCCCAGACATTTAGCTGTGGATACAGAACTGTCCTGTCAACCACCACCACCACCAAGCCCCTGCCCCTAACAATGGACACTCTGCTTCCCTGCTTCTTCTGCATCCCTGCCTTCCCACTTTCAAACCTCTTGCCCACTCTGCTCCAAACATGATGGAGTGATAACATCGGAACTTAACCAAATCATATATGTCTATTTTAATAGACACTGACTGCTCCATGTCAGCCTGGATAGAGGTATATGATCGTGTGCCAAGAATTTATCCCAGACTCCCCTGTGTGACAGCTTCATAATAAAGTTACTTAACTGTGCCTCTTCCTCCTTCCTCTCCCCACACAGGATGGATGGGCATCTTTCTCCTTGACCACCCTACTCTCCCTTCCTCCCCTGATCACCTCCCCTCCCTGCTCTTCCCTGGTGATGGACTTCTAACATGAGATTTTTTAAAAAAATTTCTATTTCTTTTATAATTTTGCTGAGTTTTCAGGGTTTCTTCTGTAAATAAAACATAATATTTAAATGGTTGGTTATGATTCTAGTTTTCTAACAATTTCTGTAATGTATCTTTCCCTTCGTCTATTTACTAACTGTCTGAAACCTTATGGGGAAGGTACAAGGGGCGTGGTGGATTAAGACATCCACTGCTTTTTACCCAGCAGGATATCTCTGTGTCTCTAAGGACCCAGGTGAGGGGAGAATATCAATTTATGATTCCTGGGTGCAGCAAGTCCCCACCCCCACTTTTCCTCTTTAGCTCCCCATCCAGATCAGCCAGAGTTCACCCCTGTCCAAGATGAGCTGGAAGCCATGGAACTGTGGGGCCCTGGAGTCTGATAGCCTCAGGAGAAATTTGAAGACCAACTGCAAGAACTCTTAAGGAATCTTGTTTGAGAAAATGTTGTTATGTGGTTTGTATGCTACTTTTGGGGGGCAGGGCTCATTTCAGCAGCCTAAATCTCCTCCTTGGATAATGTTAATATTATTATTATTATTAACAAAAAATATATATTTTTAAAAAGTTCCCTTAATCTATGACATGGTAGCAATGATTTCCCTTTGGTGTCTTAATGGCATGTCAGATAATTTGTTTTTCCAGAGAAGAGAGCTCAAAGAGGAATTGGGAAAAATAAATTGAACTCTGGAATCTTCTCTCTCAAGTCCTAAAATGAACAAACAGATATGATTGTGTTTGAGGGAAATATGTCCCTAGCAGGAAAAGAATTCAAAGAGGTTCAAAGAATATGTCACTTACTCCTACTTGCTGTAGGAATAACCTTGCTGATAAGAAAAAAAGGGACAATATTGGAGAAACTACCTCTTGTTTAATTGATCTGTCCAACTCTGAGATCACTTGGTAACTGGTTTCATGTGTATCCAAAAATCAGCATTTGGATTTAAGCTTTCTGAATTTGGTAGTTTAAGAAACAGATTTAGTTTTTCAGTGGTTTTAACTCATGTGAAATAATGATTTTCCACCAGCTCTGATGCAAAGAGATATAATTTTAATGAACGATTTATCCAGCAGTGTGTTCCAGGGGTTGCCTCTCCTTATCTACGGGGATTACTTTGTACATGCAGATAAGTTTTCGCAAACCTATTTCCATTTTCTTTTGTAAGCAAATAAAACTTTAAAACAATGTATGTGGATTCTTTTTCCTGCATTTCTAAGTATCACCTTAAGCTTTTGTAGTCTTAACTGAGTGTCCACCAGAAAGACAACAGTTGTCTTCCTTTAGGTAAGCATTCAAACTTTCATTCATTCGTTTACTCACTCACTCATTCATTCATTCTGAGTGCAGTAGAAAACAGAAGAAGCAGTTAACTTGGGACTAAGAGATTAGCGACATTTTATTGTTCATTTATAATCTAGCAGGCAGCAAAGACCCTGCAAATGCATGACCTCTGCTAAATAAATGTTTATCAATAGTTGACTGAGGAGCCCACCTATCTTCTGATATTGAGGAAAGCCTAAAAACCCCTAGAAGGCAGAGCAGAAATGAGGTTGAATCTAATAGACTCTAACCCTTAAACCATACTTTGTCTTTTGCTCACAAAGGAAAAATCTAGGTATTTGAGAAAGATTTGAATTCTATTATGTGCTAGTTGAAATAGAAACAAAAGAGAACCATAAATTTAATACGTGCTCCTTCTCTGTAACATCTCCCTAGTAACAGCTAACTTTAGAAAGTAGGGATGGGATCATTTACAACTAGAAGCTGGATTCTTTCTGGATCAGGAAAAGGCTAACACGAAGGATGGTGTCTGTCTGATCACCAGGTTCTCTTTCTGTCCTTCTCATAATCTCCTGATCTTTGGAGATGAAAGATCTCCTTTCATCTTCATCTGAAGGATTCTTCAGATGATTCATCTTCAGACTTCATCTGAAGGATTCAAACAATCTACTTGTGTGCCTTTGGTGGGGTGGGGCAGGGGCGGGGGGCGGTTCTAAACAAATCAGTTTTTTTGGTGTCTTTGCAGGGAATGAAAGAAGATAATGAGCAGATAATCAGCAGCCATTTCCTTTCAGTTATGGTATATGATTCTGCCTGAGAAAGCAGGATTTATGGGAAGGAAAACTTGTCTAAGGCTCATCAAGATGGCCTGACCCAGAGTCACCTAAGAGAACTCTTCCAACTTAAATGACTAGGGTGTGTAATCAGTTGCTTCTTATTCTGTGTCTCAGATTTCCTAGTCCATGACATTTAATAGTGAGTATAGAGTAGGATATTCTATACATTTTAGTATTTGGCCCTTGGAAACAAAGTTAAATACCATGTCACTCAGAAGACTCTCAAAGTTTGTGTATAAATGGCGAAGTATACACTATGAGAGATTCTAATCCATTCACATCATTCTTGAGTTGTGCAAATACACTTGGCTTTGATTTCACTTGGTGATCTAAATTTGTTTATTTAAGCTGCAAGAAAGTTACATTAATTTGGAATGTGTCATCACTTGGACCCAGTATATCAGATTTTTATTGAGTAAAATGTTAAAAATAATAAGTGTAACTCAGATTCTGGATGTTCGAGTTTACAATACATTGCCTGTAATAAAAGCTGATTCTGAAGTGCATTTTTCTTGACTTACTTTGGCAGAAATATACTTATATCTTAATTTATAGTTTGTAAGTTTATAC