Transcript asmbl_11267

Sequence
Transcript Sequence for observation asmbl_11267 of TGE0000096:
TGCTGGGATTACAGGCATGAGCCTCCGCCCCCGGCCTTAAATAATTCTTAAAGGAAGTAAAGTTAACTTTGAAAGAACTATCAGGATTTGGATTGACTGAAAGGAGTGGGGAAGCTTAGGGAGGAGGTGCTTGCCAGACACTGGGTCATGGCAGTGGTCGGTGAAGCTGCAGTTGCCTAGGGCAGGGATGGAGAGAGAGTCTGGGCATGAGGAGAGGGTCTCGGGATGTTTGGCTGGACTAGATTTTACAGAAAGCCTTATCCAGGCTTTTAAAATTACTCTTTCCAGACTTCATCTGAGACTCCTTCTTCAGCCAACATTCCTTAGCCCTGAATACATTTCCTATCCTCATCTTTCCCTTCTTTTTTTTCCTTTCTTTTACATGTTTAAATTTAAACCATTCTTCGTGACCCCTTTTCTTGGGAGATTCATGGCAAGAACGAGAAGAATGATGGTGCTTGTTAGGGGATGTCCTGTCTCTCTGAACTTTGGGGTCCTATGCATTAAATAATTTTCCTGACGAGCTCAAGTGCTCCCTCTGGTCTACAATCCCTGGCGGCTGGCCTTCATCCCTTGGGCAAGCATTGCATACAGCTCATGGCCCTCCCTCTACCATACCCTCCACCCCCGTTCGCCTAAGCTCCCTTCTCCGGGAATTTCATCATTTCCTAGAACAGCCAGAACATTTGTGGTCTATTTCTCTGTTAGTGTTTAACCAACCATCTGTTCTAAAAGAAGGGCTGAACTGATGGAAGGAATGCTGTTAGCCTGAGACTCAGGAAGACAACTTCTGCAGGGTCACTCCCTGGCTTCTGGAGGAAAGAGAAGGAGGGCAGTGCTCCAGTGGTACAGAAGTGAGACATAATGGAATCAGGCTTCACCTCCAAGGACACCTATCTAAGCCATTTTAACCCTCGGGATTACCTAGAAAAATATTACAAGTTTGGTTCTAGGCACTCTGCAGAAAGCCAGATTCTTAAGCACCTTCTGAAAAATCTTTTCAAGATATTCTGCCTAGACGGTGTGAAGGGAGACCTGCTGATTGACATCGGCTCTGGCCCCACTATCTATCAGCTCCTCTCTGCTTGTGAATCCTTTAAGGAGATCGTCGTCACTGACTACTCAGACCAGAACCTGCAGGAGCTGGAGAAGTGGCTGAAGAAAGAGCCAGAGGCCTTTGACTGGTCCCCAGTGGTGACCTATGTGTGTGATCTTGAAGGGAACAGAGTCAAGGGTCCAGAGAAGGAGGAGAAGTTGAGACAGGCGGTCAAGCAGGTGCTGAAGTGTGATGTGACTCAGAGCCAGCCACTGGGGGCCGTCCCCTTACCCCCGGCTGACTGCGTGCTCAGCACACTGTGTCTGGATGCCGCCTGCCCAGACCTCCCCACCTACTGCAGGGCGCTCAGGAACCTCGGCAGCCTACTGAAGCCAGGGGGCTTCCTGGTGATCATGGATGCGCTCAAGAGCAGCTACTACATGATTGGTGAGCAGAAGTTCTCCAGCCTCCCCCTGGGCCGGGAGGCAGTAGAGGCTGCTGTGAAAGAGGCTGGCTACACAATCGAATGGTTTGAGGTGATCTCGCAAAGTTATTCTTCCACCATGGCCAACAACGAAGGACTTTTCTCCCTGGTGGCGAGGAAGCTGAGCAGACCCCTGTGATGCCTGTGACCTCAATTAAAGCAATTCCTTTGACCTGTC